Cookies erleichtern die Bereitstellung unserer Dienste. Mit der Nutzung unserer Dienste erklären Sie sich damit einverstanden, dass wir Cookies verwenden.
Weitere Informationen

 

Kapitel 08.12: Molekulare Grundlagen der Vererbung (Molekulargenetik)

DNA-Modell (Foto)

Ein Ausschnitt aus der DNA

 

Variabilität der Phänotypen

Lebewesen unterscheiden sich in ihren Phänotypen. Vergleiche mal die Blätter eines Ahorns oder die der Schneebeere.

Bei Blättern liegt eine unterschiedliche Größe und eine verschiedene Ausprägung (Heterophyllie) vor. Diese Ungleichheit kommt zum Teil durch unterschiedliches Wachstum, unterschiedliche Schwerkraft und Lichteinflüsse zustande. Die Unterschiede sind zum Teil auch im Erbgut bereits vorbestimmt.

Weitere Beispiele bei Pflanzen: Licht- und Schattenblätter der Rotbuche, Blätter der Linde, Zweige der Rosskastanie oder des Spitzahorns, Blätter des Efeus usw.
Aber nicht nur Pflanzen unterschieden sich. Auch Menschen, Hunde, Katzen usw...

Jedes Lebewesen ist eine Variation innerhalb seiner Art. Kommen die Unterschiede durch Umwelteinflüsse zustande spricht man auch von Modifikationen.

Der Schwede W. Johanson fand zu Beginn des 20Jh. heraus, dass die sowohl kleine, wie auch große Gartenbogensamen Nachkommen hervorbringen, welche ebenfalls wieder große und kleine Samen trugen. Ursprünglich versuchte er Darwins Selektionstheorien zu widerlegen. Eine Korrelation kleine Bohnen bringen Pflanzen mit kleine Samen und große Bohnen bringen großsamige Pflanzen hervor konnte er allerdings nicht belegen, so dass er sich geschlagen gab und Darwins Theorien anerkannte. Er definierte darauf hin den Begriff „Genotyp“ (=Erbbild).

Schülerversuch:

Vergleiche Zweige und Blätter von Schneebeere, Stechpalme, Ginko oder anderen Pflanzen. Gemeinsamkeiten und Unterschiede werden in eine Tabelle eingetragen

 

Art

Artmerkmale

(unveränderlich)

Unterschiede & Modifikationen

Ginko

Strauch, Blätter glänzend, immergrün, Blütenfarbe weiß, Früchte rot

Blätterrand mal gezähnt, mal glatt

Schneebeere

Strauch, Sommergrün, weiße Früchte

Blattform unterschiedlich.

     

=> Phänotyp - Erscheinungsbild (Phän = Merkmal)

=> Genotyp - Gesamtheit der Erbinformation

 

Was sind Modifikationen?

Vergleiche die Blätter der Schneebeere:

Blätter der Schneebeere

 

Schon zu Beginn des 20. Jahrhunderts bemerkten Biologen, dass die Größe der Nachkommen einer Bohnenpflanze zwischen 10 und 19mm variieren kann. Ein aussähen von großen oder kleinen Bohnen brachte nicht etwa nur große oder nur kleine Bohnen hervor, sondern wieder ein Gemisch aus Bohnen verschiedener Größen. Man nannte dieses Phänomen „Modifikation“.

Modifikationen sind Phänotypänderungen der Form und Gestalt, welche nicht auf Vererbungs­vorgänge zurückzuführen sind. Vielmehr stellen sie die Variationsbreite eines Merkmales dar, welches durch eine erblich bedingte Reaktionsnorm festgelegt ist. Faktoren wie Licht, Temperatur, der Boden, der generelle Standort und Nahrung/ Ernährung sind dabei entscheidende Einflussfaktoren.

In der Tierzucht kann man dieses ebenfalls beobachten. Nur eine optimale Haltung, gute eiweißreiche Nahrung, saubere Haltungsbedingungen, vitaminreiche Nahrung, ausreichend Bewegung usw. sorgen für maximale Qualität des Fleisches.


Aufgaben

1. Wie erklärst Du eigentlich die Tatsache, das heute die Schüler im Schnitt 10-15cm größer sind als vor 30 Jahren?

 

Genübertragung und Genaustausch bei Sexualvorgängen höherer Lebewesen

Der Birkenspanner als Beispiel für Mimese

Mimese (Griechisch = Nachahmung) ist eine Tarnungsform, bei der Objekte wie z.B. Rinden, Böden, Steine usw. durch Pflanzenteilen oder Tiere zur Überlistung von Fressfeinden imitiert werden.

Der Birkenspanner ist ein weißer Schmetterling, der durch seine Farbe gut auf Birken getarnt ist. Durch eine Mutation gibt es allerdings auch eine (seltenere) fast schwarze Variante.

 

 

Mutation &

Rekombinationen

Befruchtungsvorgänge

(Genübertragung)

 

 

 

 

Umweltänderungen

 

 

Lebewesen in

seiner Urform

genetische

Varianten

Selektion
der
Umwelt

Birkenspanner

(Hellform)

--------------------->

Birkenspanner

(Dunkelform)

-------------------->

Verrußung der Birken durch Industrieabgase

 

=> v.a. die Dunkelform gibt ihre Gene weiter!

 

Wirkung der natürlichen Selektion:

  • Die Selektion kann benachteiligend wirken => Aussterben der Variante
  • Die Selektion kann vorteilhaft wirken => Vermehrung, Verbreitung und Weiterentwicklung der Variante

 

Der Birkenspanner

Birkenspanner, weiß

 

Birkenspanner, dunkel

Quelle Bilder: CC-BY-SA-2.5 and GNU FD by Wikicommonsuser Olaf Leillinger - Danke! Birkenspanner weiß: http://commons.wikimedia.org/wiki/Image:Biston.betularia.7200.jpg, Birkenspanner schwarz: http://commons.wikimedia.org/wiki/Image:Biston.betularia.f.carbonaria.7209.jpg

Zusatzinformationen:

http://de.wikipedia.org/wiki/Birkenspanner

http://commons.wikimedia.org/wiki/Image:Lichte_en_zwarte_versie_berkenspanner.jpg

 

 

DNA & Chromosomen

  • Der Elementarfaden (=Chromatinfaden) ist pro menschliche Zelle ca. 2.2m lang. Damit er überhaupt in die Zellen passt, ist er durch Schraubung 1., 2. und 3. Grades verkürzt.
  • Meiose: Bildung von Keimzellen (=Gameten) mit haploidem Chromosomensatz.
  • Die Enden der Chromosomen werden als Telomere bezeichnet. Sie sind durch eine bestimmte, sich wiederholende DNA-Sequenz gekennzeichnet. Bei jedem Mitosedurchgang wird das Chromosomen dabei ein kleines Stück an den Telomeren kürzer.
    => Nach ca. 100 Zellteilungen nimmt die Qualität der neu entstandenen Zellen und des Erbgutes ab.
    => Nicht jede Zelle ist somit beliebig teilungsfähig.
    => Telomere sind zum Teil ausschlaggebend für Alterungsprozesse im Körper (u.a. der Haut).
  • Bei Bakterien gibt es keine Chromosomen, da ihre ringförmige DNA nicht spiralisiert werden kann.
  • Es liegen in der Regel zwei homologe Chromosomenpaare vor (diploider Chromosomensatz). In den Keimzellen gibt es aber auch haploide Zellen mit einfachem Chromosomensatz.
  • Ein Abschnitt auf einem Chromosom wird Gen genannt. Der Mensch verfügt über rund 30000 Gene
  • Das Wort Chromosom ist vom Griechischen („chromos“ = Farbe) abgeleitet.
  • Bitte beachten: Der Plural ist Chromosomen! Das Wort „Chromosome“ existiert nicht.
  • Thomas Hunt Morgan beweist durch Experimente 1910, dass die Chromosomen Träger der Erbinformation sind, außerdem erstellte er erste Chromosomenkarten.
  • Aussagen über die Entwicklungshöhe eines Lebewesens können nicht durch die Anzahl an Chromosomen getroffen werden!
  • Menschen, Tiere sowie fast alle Pflanzen haben 2 Geschlechtschromosomen (XX= weiblich; XY= männlich). Sie werden auch Gonosomen genannt. Die Körperchromosomen hingegen sind die restlichen 22 homologen Chromosomenpaare. Sie werden auch Autosomen genannt. Eine Ausnahme besteht bei Vögeln. Hier ist das Männchen homogametisch (XX) und das Weibchen heterogametisch (XY).
  • Mitose: Bildung von Körperzellen mit diploidem Chromosomensatz.
  • Einstrang-Hypothese“: Chromosomen bestehen aus zwei Chromatiden. Jedes Chromatid ist nur von einem einzigen DNA-Doppelstrang durchzogen (mittlerweile wissenschaftlich belegt durch Autoradiographie - die Hypothese ist also im Grunde keine mehr *g*).
  • Der eigentliche Elementarfaden des Erbguts besteht aus DNA, die um Histonkomplexe gewickelt ist.
    Die blau beschriftete 10nm Fiber (DNA mit Nucleosomen) ist spiralförmig zur nächsthöheren Faltungsstruktur aufgewickelt (30nm Fiber), welche wiederum spiralförmig aufgewickelt ist.
    => 3 fache Spiralisierung der DNA.

Elementrarfaden DNA - Windung der DNA um Histonemehrfache spi

  • Chromosomen kann man (z.B. für lichtmikroskopische Untersuchungen) färben. Man erkennt dann auf dem Chromosom verschieden helle Abschnitte (=Banden). Die Färbbarkeit bestimmter Regionen des Chromosoms hängt vom Grad der Spiralisierung ab.

 

Feinstruktur der Chromosomen

dreifache Spiralisierung der CHromosomen - Feinbau der CHromosomen

 


Quelle Bild: Public Domain by www.genome.gov & Wikicommonsuser Phrood; Thank you http://www.genome.gov/Pages/Hyperion//DIR/VIP/Glossary/Illustration/chromosome.shtml http://commons.wikimedia.org/wiki/Image:Chromosom.svg

Achtung: Zeichnerische Ungenauigkeit: Das Telomer ist als Ende des Chromosoms definiert, folglich kann aus ihm keine Chromatinfiber mehr hervorkommen!

 

Extrachromosomale Vererbung

Unter dem Begriff extrachromosomaler Vererbung (auch cytoplasmatischer Vererbung) versteht man die Weitergabe von Genen, welche bei Eukaryoten außerhalb des Zellkerns liegen. Extra bedeutet soviel wie „außerhalb“ und bedeutet in diesem Sinne soviel wie „DNA, außerhalb des Zellkerns. Extrachromosomale DNA findet man bei Bakterien in Plastiden und bei Eukaryoten z.B. in Mitochondrien und Chloroplasten. Letzte werden als semiautonome Organellen. Sie verfügen über eine eigene DNA und in der Regel über eigene Zellteilung.

Evolutionsbiologisch sind diese Organellen vermutlich einigen Milliarden Jahren als Einzeller von größeren Einzellern aufgenommen, aber nicht verdaut worden. Stattdessen lebten sie in einer Symbiose gemeinsam zum gegenseitigen Nutzen, bis nach vielen Millionen Jahren die Organellen ihre Eigenständigkeit zum Teil einbüßten. Die Theorie, die dies erklärt ist die „Endosymbiontentheorie“.

Untersuchungen von extrachromosomaler DNA ist für Anthropologen und Archäologen von größter Bedeutung. Durch die geringe Veränderung dieser DNA kann man Stammbäume über lange Zeiträume hinweg aufstellen.

Die Besonderheit der exrachromosomalen Vererbung liegt in der Tatsache, das diese Gene nur von Frauen weitergegeben werden. Der Grund ist offensichtlich: Weibliche Keimzellen enthalten immer deutlich mehr Cytoplasma als Spermien und wenn ein Spermium in diese eindringt, dann ohne Mitochondrien.

Extrazelluläres Erbgut befindet sich in z.B. Mitochondrien und Chloroplasten und wird immer nur über die mütterliche Linie vererbt (bei Tier und Pflanze).
Die Mitochondrien der Spermien dringen nicht in die Eizelle ein.

Somit gelten für diesen Vererbungstyp die Mendelschen Regeln nicht.

 

DNA-Extraktion von DNA aus Zwiebeln

Material:

  • gekühlter Brennspiritus (-18°C) (anstelle reinem Ethanol,welches zu teuer ist
  • Trichter mit Filterpapier
  • ein Wasserbad (Becherglas oder Topf mit Wasser),
    Gefäß mit kaltem Wasser und evtl. Eiswürfeln,
  • eine mittelgroße Zwiebel,
  • ½ Teelöffel Kochsalz
  • 5-10ml Spülmittel,
  • 75ml Wasser,
  • ein schmales Becherglas & ein Reagenzglas
  • Mörser,
  • Feinwaschmittel,
  • Glasstab oder Holzstab

 

V: Mische Wasser, Spülmittel und Kochsalz in dem Becherglas. Dann schneide die Zwiebel in sehr kleine Stückchen (je kleiner, desto besser). Gib die Zwiebelstücke in die Lösung. Stelle das Becherglas mit der Lösung nun in das 60°C warme Wasserbad. Nach 15 Minuten nimm es heraus und kühle es einige Minuten in kaltem Wasser, so dass Du weiterarbeiten kannst. Um an die DNA zu gelangen, zermörsere die Zwiebeln (nicht zu stark, sonst wird die DNA zu stark beschädigt!), bis ein körniger Brei entsteht.Nun wird alles abfiltriert. Von dem Filtrat (der Flüssigkeit!) werden ca. 2ml mit einigen Körnern Feinwaschmittel vermischt. Dieses enthält das Enzym Protease, welches weitere Zellproteine zersetzt. Nachdem alles gut vermischt ist, wird das Gemisch vorsichtig mit eiskaltem Alkohol (Spiritus) überschichtet.

Nun kann man beobachten, wie die DNA schlierenartig aus der Alkohollösung nach unten als Feststoff ausfällt. Sie kann mit einem Stab entnommen werden.

 

Aufbau der DNA

Quantitative Analyse der DNA durch saure Hydrolyse

Hydrolysiert man DNA und durch Kochen und Zugabe von Säuren, entsteht ein Hydrolysat aus den Bestandteilen Zucker, Phosphorsäure (eigentlich Phosphat in der DNA!) und 4 verschiedenen organischen Basen. Das Molverhältnis von Zucker : Phosphorsäure ist dabei 1 : 1.

 

Bausteine der DNA:

  • vier organische stickstoffhaltige Basen
  • Phosphorsäure
  • C5-Zucker Desoxyribose

 

Die vier Chargaff-Regeln:

Der Wiener Erwin Chargaff zeigte 1950 experimentell, dass zwischen den Basen Adenin und Thymin ein Verhältnis von 1: 1 (A : T) sowie von Guanin : Cytosin = 1: 1 (G:C) vorliegt. Er folgerte daraus, dass die jeweiligen Paare zu so genannten Basenpaaren miteinander kombiniert sind. Er stellte genau Regeln auf, welche die Grundlage zum späteren Verständnis des DNA-Aufbaus waren:

  • Die Basenzusammensetzung der DNA ist von Spezies zu Spezies unterschiedlich. Die DNA jeder Spezies besteht nur aus den vier Grundnukleotiden Adenosin, Thymidin, Guanosin, Cytidin (=dAMP, dCMP, dGMP und dTMP). Deren Anordnung ist unterschiedlich.
    Liegt als Zucker dabei Desoxyribose vor, so kann das Nukleotid durch ein vorangestelltes d dieses symboilisieren: dAMP, dCMP, dGMP und dTMP).

  • Verschiedene DNA-Proben aus unterschiedlichen Geweben eines Individuums sind gleich. Die Basenzusammensetzung der DNA einer Spezies ist unabhängig von Alter, Ernährungszustand und Lebensraum.
  • In allen DNA-Molekülen gilt: A=T und C=G und A+G=T+C

  • Purin-Nukleoside enden auf -osin, Pyrimidin-Nukleoside auf -idin.

=> Ein Basenpaar besteht immer aus 2 Basen. Es verbinden sich immer Adenin mit Thymin sowie Guanin mit Cytosin (und umgekehrt).

 

Aufgaben:

1. Erkläre den Ablauf und das Ergebnis einer sauren Hydrolyse von DNA

2. Was besagen die „Chargaff-Regeln”? Was kann an der vierten Regel leicht missverstanden werden?

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Desoxyribonukleinsäure

http://de.wikipedia.org/wiki/Erwin_Chargaff

 

Die Bausteine der DNA im Detail

1. Phosphorsäure: H3PO4 bzw. Phosphat: (PO4)3-

2. Desoxyribose

Desoxyribose

 

 

3. Die vier Nukleinbasen (sowie Uracil1)

die fünf Nukleinbasen (mit Uracil)

 

Was bedeuten die Begriffe Purin und Pyrimidin?

Ganz einfach, so werden zwei Verbindungen in der organischen Chemie genannt, welche zum einen cyklisch sind, aber auch außer Kohlenstoff noch Stickstoff in der Hauptkette enthalten. Man spricht auch von „heterocyclischen Kohlenwasserstoffen“. Beide Verbindungen tauchen in der Natur auf und sind im menschlichen Organismus in viele Abwandlungen zu finden. Aus ihnen leiten sich die DNA-Basen ab.

 

Purin und Pyrimidin

 

Nucleosid & Nukleotid

Die Verknüpfung von Zucker und Base wird als Nucleosid bezeichnet.
Die Verknüpfung von Nucleosid + Phosphorsäurerest wird als Nukleotid bezeichnet.

Nucleosid & Nukleotid

 

Beachte:

  • Man spricht meistens entweder von Basen oder von Nocleotiden.
  • Der Begriff Nucleosid wird hingegen etwas weniger oft verwendet.
  • Nukleotide werden manchmal auch als Nukleosid-mono-Phosphat bezeichnet.
  • Die Namen der Basen sind (zur Unterscheidung) minimal dadurch verändert!
    C = Cytidin
    T = Thymidin
    A = Adenosin
    G = Guanosin
  • Es gibt DNA und RNA Nukleotide

 

Ein Nukleotid im Detail (am Beispiel der Thymidin-Nukleotiden):

Thymidin-DNA-Nukleotid Thymidin-RNA-Nukleotid

Thymidin-DNA-Nukleotid

 

 

Thymidin-RNA-Nukleotid

Thymidin-RNA-Nukleotid

 

Bei DNA befindet sich anstelle der Ribose eine Desoxyribose. Diese unterschiedet sich v.a. durch den fehlenden Sauerstoff am 2. Kohlenstoff! Siehe auch: http://de.wikipedia.org/wiki/Desoxyribose

Zusatzinformationen:

http://de.wikipedia.org/wiki/Pyrimidin

http://de.wikipedia.org/wiki/Purin

 

Geschichte der Entschlüsslung des Erbguts

1951 Alexander Robert Todd

Er bewies 1951, dass die Primärstruktur der DNA eine Folge von Nukleotiden ist.

Wenige Nukleotide miteinander verbunden nennt man dabei Oligonukleotid.

 

1952 Maurice Wilkins

Der Neuseeländer zeigte durch Röntgenstrukturanalyse: „Die DNA ist eine Doppelschraube“

 

1953 Watson und Crick entschlüsseln die DNA

Der Amerikaner James Watson ging 1951 nach Cambridge, um mit Francis Crick ein Strukturmodell der DNA zu entwickeln. Für ihre Entdeckung bekamen sie zusammen mit Wilkins 1953 den Nobelpreis.

 

Biographie James Deway Watson (*1928)

  • Amerikanischer Biochemiker,
  • entdeckte zusammen mit Crick und den Röntgenphysikern Maurice Wilkins und Rosamund Franlin die Molekularstruktur der DNA
  • 1950 erste Arbeit an der Universität über Bakteriophagen promoviert
  • 1951 Übersiedlung nach England und zur Forschung an der DNA- Struktur
  • Veröffentlichung der Ergebnisse 1953 im Naturwissenschaftsmagazin „Nature“
  • 1961-1976 Professor an der Harvard University
  • 1962 Nobelpreis in Medizin für die Entschlüsslung des Erbguts
  • 1976- 2007 Direktor des Cold Spring Habor Labor auf Long Island
  • 2007 Suspension aufgrund rassistischer Äußerungen

 

Biographie: Francis Harry Crick (1916- 2004)

  • Englischer Physiker und Biochemiker
  • 1937 Abschluss eines Physikstudiums
  • Tätigkeit bei der Marine als Entwickler von Seeminen
  • 1947 Spätes Studium der Biochemie
  • 1951-1953 Zusammenarbeit mit Watson, Welkins und Franklin beim Molekularmodell der DNA
  • 1962 Nobelpreis in Medizin für die Entschlüsslung des Erbguts
  • Übersiedlung nach Amerika und Tätigkeit am kalifornischen Institut La Jolla
  • 2004 Tod durch Darmkrebs

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Nukleinbasen

http://de.wikipedia.org/wiki/Adenin

http://de.wikipedia.org/wiki/Cytosin

http://de.wikipedia.org/wiki/Guanin

http://de.wikipedia.org/wiki/Uracil

 

Verknüpfung der Nukleotide zum DNA-Strang

a) Die Verknüpfung der Basen

Das Nukleotid ist der eigentliche DNA-Baustein. Die Verknüpfung der Nukleotide findet jeweils über ein Phosphat am 3‘ Kohlenstoff der Ribose statt. Da Phosphat selbst am
5‘ Kohlenstoff verbunden ist, spricht man auch von er 3‘ - 5‘ Kettenform.

Die Verknüpfung der Nukleotide geschieht jeweils am 3‘- und am 5‘-Ende des beteiligten Zuckers (Desoxiribose bei DNA bzw. Ribose bei RNA). Da sich dieses kontinuierlich über den ganzen Strang fortsetzt, kann man jedem DNA-Strang (bzw. RNA-Strang) ein 3‘-Ende und ein 5‘-Ende zuweisen- Die Ableserichtung des DNA-Strangs ist immer von 3‘-Ende zum 5‘-Ende.

Beachte zuerst nur die linke Seite des Strangs!

 

Verknüpfung des DNA-Strangs

 

 

 

Die linke Seite (hier im Bild) wird als Leitstrang bezeichnet. Sie ist vom 3'-Ende zum 5'-Ende aufgebaut und hat jeweils den Zucker Desoxyribose mit einem Phosphat verknüpft. Am ersten Kohlenstoff ist jeweils die Base gebunden.

Wie man deutlich erkennt, verläuft eine entsprechende Kette in die entgegengesetzte Richtung! Sie wird als Folgestrang bezeichnet. Diese verläuft genau entgegengesetzt, so als seien Phosphat und Zucker auf den Kopf gestellt. Die Basen sind komplementäre (also entsprechende) Ergänzungen der gegenüberliegenden Basen des Leitstrangs.

Man sagt, die DNA besteht aus zwei miteinander verknüpften antiparallel verlaufenden Einzelsträngen. Diese bestehen aus Nukleotiden, welche je ein Zuckermolekül (Desoxyribose), ein Phosphat (am 5’ Ende gebunden) und einer Purin- oder Pyrimidinbase (A, G bzw. T, C) enthalten.

Die Basen eines Stranges sind komplementär zu denen des zweiten Stranges. A ist mit T sowie C immer mit G verknüpft.

 

Zusammenfassung: Aufbau der DNA

Die DNA besteht aus zwei Strängen, welche zu einer Doppelhelix verwunden sind. Beide Stränge werden durch Wasserstoffbrückenbindungen zusammengehalten. Man kann sich den Aufbau somit als eine verdrehte Strickleiter vorstellen. Die beiden Stränge verlaufen antiparalell zueinander.

Die Außenseite der Strickleiter („die Holme“) werden abwechselnd aus Phosphat und Zuckermolekülen (Desoxyribose) gebildet. An den Zuckern hängt jeweils nach innen ragend eine der vier möglichen stickstoffhaltigen Basen (Adenin, Thymin, Cytosin oder Guanin). Die Basen verbinden sich (zu den „Sprossen“ der Leiter) jeweils mit der gegenüberliegenden Base komplementär (A mit T, T mit A, C mit G und G mit C). Dabei verbinden sich A mit T immer mit zwei Wasserstoffbrückenbindungen und C und G mit drei WBB).

Nach außen trägt die DNA negative Ladungen der Phosphatreste.

Fasst mal als ein Baustein der DNA jeweils ein Phosphat, einen Zucker und eine Base zusammen, spricht man auch von einem Nukleotid. Die Verknüpfung der Nukleotide untereinander geschieht jeweils am 3‘ und am 5‘-Ende des Zuckers (siehe Zeichnung). Da diese Verknüpfungen von Baustein zu Baustein die ganze DNA durchziehen, kann man den beiden DNA-Einzelsträngen jeweils ein 3‘ und ein 5‘-Ende zuordnen!

 

b) Informationen zur DNA

  • Ca. 300- 1000 Basenpaare (Bp) entsprechen einem Gen
  • Da Phosphat in der DNA noch zwei negative Ladungen besitzt, ist die DNA negativ geladen!
  • unter Sekundärstruktur versteht man die Zusammenlagerung von 2 Polynukleotidketten zu einer Doppelhelix.
  • Die Basensequenz (=Reihenfolge der Basenpaare) ist die eigentliche Codierung des Erbgutes und der Gene eines Lebewesens.
  • Die Desoxyribosemoleküle stehen senkrecht zu den Basen.
  • in jedem Teilstrang liegt ein bestimmter Richtungssinn vor (es gibt ein 3’-Ende und ein 5’-Ende).
  • Die zueinander passenden Basen bezeichnet man als komplementäre Basenpaare.
  • die „Sprossen“ der „Strickleiter“ bestehen aus komplementären Basenpaaren (Adenin - Thymin, Thymin - Adenin, Guanin - Cytosin und Cytosin - Guanin). Das heißt die Reihenfolge der Basen in der einen Kette bestimmt die Abfolge der Basen in der zweiten Kette!
  • Vergleicht man die DNA mit einer Strickleiter, so wären die „Holme“ von regelmäßigen Folgen aus Phosphat-Zucker-Ketten gebildet
  • Die Stränge verlaufen in entgegengesetzter Richtung, d.h. sie sind antiparallel.
  • Die DNA ist aus vier verschiedenen Nukleotiden aufgebaut (Ein Nukleotid besteht aus Desoxyribose, einer Phosphatgruppe und einer der vier Basen Cytosin, Thymin, Adenin und Guanin)
  • Die beiden Ketten der DNA sind rechtsgewunde Molekülketten. Sie verlaufen antiparallel.
  • Chromosomen bestehen aus DNA, welche aus zwei Polynukleotidsträngen besteht.
  • die DNA besteht aus zwei langen Molekülketten, welche zu einer Doppelschraube gewunden sind und einen Polynukleotid-Doppelstrang (=Doppelhelix) darstellen - entsprechend den Eiweißen kann man auch hier von einer Sekundärstruktur sprechen.
  • Die DNA ist ein Makromolekül
  • Die DNA liegt meist doppelsträngig vor. Und bilden eine Doppelhelix.
  • Jeder Strang hat ein 3‘ und ein 5‘ Ende.
  • Das Phosphat eines Nukleotids ist am 5’-Ende des Zuckers gebunden und knüpft mit dem 3’-Ende eines weiteren Nukleotids eine feste Bindung.
  • Ein Basenpaar besteht immer aus einer Purin- und einer Pyrimidinbase
  • Die Einzelstränge sind komplementär („umgekehrte“ Entsprechung)
  • =) beide Teilstränge sind antiparallel angeordnet.
  • Im Grunde besteht die ganze Kette aus abwechselnd angeordneten Phosphorsäureresten und Desoxyribosemolekülen (von denen die Basen abgehen). Untereinander sind Phospat und Zucker durch 3’, 5’-Phosphodiesterbindungen verbunden.
  • Die Ebenen der Zuckermoleküle sind immer 0,34 nm voneinander entfernt. Die Ebenen der Zuckermoleküle stehen in einem Winkel von 36°. Für eine vollständige Drehung der DNA sind also 10 Basenpaare notwendig. Somit erfolgt eine vollständige Windung (Drehung) nach 10 Basen, (360°). Eine Windung hat dann die Länge von 3,4 nm.
  • die Doppelhelix wird durch Wasserstoffbrückenbindungen zwischen den der Basenpaaren AT bzw. CG und Stapelkräfte stabilisiert (Bindung durch die Purin- bzw. Pyrimidinbasen).
  • Bei Menschen liegen ca. 3 Mrd. Basenpaare (bp) vor.
  • Man schätzt, dass Menschen über ca. 90.000 Gene und ca. 10.000 Origins (ori) verfügen.

 

DNA und RNA:

  • RNA unterscheidet sich durch den Zucker (Ribose) und durch eine Base. Thymin wird hier durch Uracil ersetzt.
  • Neben der DNA gibt es eine weitere Form, die RNA (RiboNucleinAcid). Sie wird innerhalb der Zelle, z.B. beim Versenden von Botschaften (=messenger-RNA) oder als so genannte transfer-RNA bei der Proteinbildung (in den Ribosomen) verwendet.
  • Genauere Informationen zu den Unterschieden von DNA und RNA folgen einige Seiten weiter.

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Alexander_Robert_Todd

http://de.wikipedia.org/wiki/Maurice_Wilkins

http://de.wikipedia.org/wiki/James_Watson

http://de.wikipedia.org/wiki/Francis_Crick

 

Übung: Erstelle einen DNA-Abschnitt der Sequenz AGCTGTCA

 

DNA-Puzzle (Freiarbeit DNA & Vererbung))


Die Wasserstoffbrückenbindungen zwischen den Basen halten die Stränge zusammen

 

Die Wasserstoffbrücken entstehen spontan immer zwischen einer Purinbase und ihrer entsprechenden Pyrimidinbase. Sie wird zwischen einem am Stickstoff verbundenem Wasserstoff und dem gegenüber­liegendem Sauerstoff gebildet. In der Chemie gilt immer, dass die Bildung von Bindungen Energie freisetzt. Im Gegenzug wäre also das Trennen der Wasserstoffbrückenbindungen ein Vorgang, der Energie benötigt. (Vergleichbar mit dem Auseinanderziehen zweier Magnete).

Voraussetzungen für das Zustandekommen von Wasserstoffbrückenbindungen sind polare Atombindungen zwischen Atombindungen z.B. Kohlenstoff und Stickstoff sowie Kohlenstoff und Sauerstoff (Fluor wäre auch denkbar, hat aber in der Biologie kaum in diesem Zusammenhang Bedeutung). Die zweite Voraussetzung ist ein Wasserstoffatom, welches an das polar gebundene
N oder O Atom gebunden ist. Beim Bindungspartner muss nun noch, als dritte Voraussetzung, ein freies Elektronenpaar vorhanden sein.

Zwischen dem Wasserstoffatomen und dem freien Elektronenpaar kommt es aufgrund des Dipols nun zu einer schwachen Anziehung. Beachte: Zwischen Adenin und Thymin bilden sich zwei WBBs, zwischen Guanin und Cytosin bilden sich drei WBBs. Das Vorhandensein von Wasserstoffbrückenbindungen (WBB) führt zu einer Veränderung der Eigenschaften. So haben Moleküle typischerweise einen höheren Schmelz- und Siedepunkt, je mehr WBB sie ausbilden.

 

Aufgaben:

1. Zwischen Adenin und Thymin kommen nur zwei Wasserstoffbrückenbindungen zustande - obwohl sich auch dreimal Stickstoff und Sauerstoff gegenüberstehen. Wenn Du in der Skizze oben schaust, was vermutest Du, warum kommt keine Bindung zwischen dem unteren Stickstoff des Adenins und dem unteren Sauerstoff des Thymins zustande?

2. Wiederhole den Unterschied Adenin und Adenosin, bzw. Thymin und Thymidin.

 

Zusammenfassung:

Die DNA ist aufgebaut aus: Zucker, Phosphat und vier Basen (Thymin, Cytosin, Adenin, Guanin)

Der Grundbaustein der DNA ist das Nukleotid.

Die DNA bildet einen helixartig gewundenen Doppelstrang (=Doppelhelix)

Basenpaarung der DNA

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Desoxyribonukleinsäure

 

Die identische Verdopplung der DNA (= Replikation bzw. Reduplikation)

a) Vorüberlegungen zur identische Verdopplung der DNA

Nachdem man nun wusste, wie die DNA aufgebaut ist, stellte sich die Frage, wie sich die DNA, z.B. bei der Mitose, vervielfältigt.

 

3 mögliche Mechanismen könnte man vermuten:

Konservativer Mechanismus:
Dabei werden die zwei neuen Stränge komplett gleichzeitig kopiert und zu einem Molekül zusammengesetzt.

 

Semikonservativer Mechanismus:
Der DNA Doppelstrang wird getrennt. Dann wird er strangweise, gleichzeitig kopiert und neu ergänzt.

 

Disperser Mechanismus:

Die DNA wird abschnittsweise kopiert. Beide Stränge sind teilweise aus neuen und alten Bestandteilen entstanden.

Die Frage in den 50er Jahren war nun, wie kann man beweisen, wie sich DNA tatsächlich repliziert. Aufgrund der Größenverhältnisse ist ein einfaches Nachgucken natürlich nicht möglich gewesen.

 

1958 Meselson/ Stahl: Versuche zur Bestimmung des tatsächlichen Replikationsmechanismus

Ernährung von wenigen E. coli Zellen mit „schwerem Stickstoff 15N (das ist ein schwereres Isotop des Stickstoffs. Dies kann leicht durch seine Masse nachgewiesen werden). Die Zellen nehmen den schweren Stickstoff auf und bauen ihn in ihre DNA ein. Der schwere Stickstoff wurde in Form von Ammoniumchloridlösung zugefügt (15NH4Cl).

Dann, kurz vor Versuchsbeginn, erfolgte eine Umstellung der Bakterienernährung auf normalen Stickstoff 14N (durch normales Ammoniumchlorid 14NH4Cl).

Nun wartet man genau solange, bis sich die Bakterien einmal geteilt haben (also eine Verdopplung stattfindet). Dann, nach der 1. Zellteilung, erfolgte eine Entnahme von DNA-Proben. Diese Proben wurden anschließend zentrifugiert. Durch die Zentrifugation findet eine Trennung innerhalb des Gefäßes nach der Masse statt. Je weiter unten ein Stoff ist, desto schwerer ist er.

Es wurde in einem zweiten Versuch doppelt so lange gewartet - solange bis die zweite Zellteilung komplett abgeschlossen war. Erneut wurde eine Probe zentrifugiert und untersucht.

 

Beobachtungen:

a) So sieht das Ergebnis einer Zentrifugation der Bakterienkultur aus, welche nur mit 15N gefüttert wurde:

 

Meselson und Stahl Experiment zum Replikationsmechanismus der DNA


 

Schlussfolgerungen:

Die Leistung von Meselson und Stahl bestand darin, durch logische Rückschlüsse der Gewichtsverhältnisse Aussagen zur DNA zu treffen - Hut ab!

Bezieht man nun die tatsächlichen Verhältnisse auf ein Abschnitt der DNA, so ist dieser schwer, solange die Bakterien kein 14N bekommen haben. Nach der ersten Zellteilung (1. Tochtergeneration) und Gabe von 14N ist das Gewicht geringer, da jeder neue Strang eine Mischung aus alter und neuer DNA ist.

Nach der zweiten Zellteilung findet man hingegen ein Gemisch aus leichten Bakterien (also leichter DNA, welche nur aus 14N besteht und mittlerer DNA, da diese aus einem Gemisch aus 14N und 15N besteht.

Ergebisse des Meselson Stahl Experiments

Unterscheidung nach der 1. TG:

Beim konservativen Mechanismus wäre dies nicht der Fall, zwei Banden würden entstehen (eine für leichte und eine für schwere DNA).

Ergbnisse des Meselson Stahl Versuchs, UNterscheidung nach einer TG

Beim einer dispersen Replikation wäre hingegen das Ergebnis wie bei einer semikonservatien. Eine zweite Tochtergeneration ist zur Unterscheidung also notwendig!

 

Unterscheidung nach der 2. TG:

Die zweite Tochtergeneration zeigte im Versuch von Meselson und Stahl zwei Banden. Die obrige Grafik erklärt, wie es zu dieser Aufspaltung kommt. Dieses Ergebnis ist aber nur bei einer semikonservativen Replikation möglich! Ein disperser Mechanismus hätte nur eine Bande zum Vorschein gebracht!

=> Der neue Stickstoff wird bei der Replikation strangweise eingebaut. => Die DNA wird mit dem semikonservativer Mechanismus repliziert!

 

Aufgaben:

1. Welche Ergebnisse erwartest Du nach einer dritten Replikation?

2. Zeichne die zu erwartenden Ergebnisse (als Reagenzglas) für einen Hypothetischen konservativen und dispersen Replikationsmechanismus und begründe anhand von DNA-Skizzen.

 

Übersicht über Meselson & Stahls Experiment

 

Ergbnisse des Meselson-Stahl-Experiments

 

Quelle Bild: Public domain by Wikicommonsuser LadyofHats, Marina Ruiz - Muchas gracias; http://commons.wikimedia.org/wiki/Image:Meselson-stahl_experiment_diagram_en.svg

 

Zusatzinformationen zu Meselson & Stahl: Die Methode der Dichtegradienten-Zentrifugation

Eine stark konzentrierte Cäsiumchloridlösung wird 48h (!) zentrifugiert. Dabei werden selbst die enthaltenen lonen zum Boden des Zentrifugenröhrchens gedrückt. Daraus folgt ein Konzentrationsgradient (=Konzentrationsunterschied von unten nach oben) der Ionen. Dem entgegen stehen Diffusionskräfte, welche diesen Unterschied wieder ausgleichen würden.

Es stellt sich also ein Gleichgewichtszustand zwischen Diffusionskraft und Zentrifugalkraft ein (Ionen diffundieren nach oben, werden aber durch die Zentrifugation wieder nach unten gedrückt). Wenn man nun, nach Einstellung des Gleichgewichts einen Stoff zufügt, so lagern sich dessen Teilchen in der Schicht an, welche eine entsprechende Dichte hat. Dies ist dann als Bande sichtbar.

=> Schwerere Teilchen haben eine höhere Dichte und sind tiefer wiederzufinden als Teilchen mit geringerer Dichte.

 

Zusatzinformationen zu den Experiment von Meselson & Stahl (1958)

  • Die Bakterien aus dem zweiten Ansatz wurden nun nach einem langen Wachstum auf 15N-Nährböden auf ein Nährmedium mit 14N überführt. Die Wissenschaftler ließen die Bakterien auf diesen Böden für die Dauer eines Replikationszyklusses
  • Die beiden Isotope 14N und 15N unterschieden sich in ihrem Atomgewicht und sind somit auch im Labor durch ihre verschiedene Masse unterscheidbar.
  • Eine Suspension der Bakterien-DNA wird anschließend zentrigugiert (Dichtezentrifugation) und zeigt das „normale“ Ergebnis:
  • Meselson und Stahl ließen Bakterien auf Nährboden wachsen, welcher als Stickstoffquelle 14N zugegeben ist (also Stickstoff mit 7 Protonen und 7 Neutronen).
  • Wie zu erwarten, nahm die Anzahl der Bakterien durch mitotische Zellteilungen zu. Der vorliegende Stickstoff wird von den Bakterien in die DNA eingebaut.
  • Nun züchteten sie die beiden Bakterien über mehrere Generationen hinweg auf einem Nährboden, welcher ausschließlich den sogenannten schwerern Stickstoff, einem Isotop, 15N (Stickstoff mit 7 Protonen und 8 Neutronen) enthielt.
  • Durch Zentrifugation zeigten die beiden, dass diese Bakterien in ihre Bakterien-DNA nun nur 15N-Stickstoff eingebaut hatten.

 

Aufgaben:

1) Beschreibe die Beobachtungen der ersten beiden Versuche mit eigenen Worten

2) a) Welche Ergebnisse sind nun zu erwarten, wenn man von einer (!) semikonservativen Replikation ausgeht. Zeichne die Banden nach einer Dichtegradientenzentrifugation ein.

b) Welche Banden sind nach dem ersten Replikationszyklus einer konservativen Replikation zu erwarten?

 

Kleiner Exkurs: ATP, GTP, TTP, CTP

ATP ist der wichtigste Energielieferant der Zelle. Erinnere Dich mal daran, das die meiste chemische Energie in Atombindungen steckt. ATP ist nichts anderes als ein Adenosin verbunden mit drei Phosphaten (=Adenosintriphosphat). ATP wird z.B. während der Zellatmung gebildet. Dazu wird Energie benötigt!

ATP:

 

ATP - Formel

 

 

ADP

ADP - Formel

 

Quelle Bilder: Public domain by Wikicommonsuser Neurotiker - thank you; http://de.wikipedia.org/wiki/Bild:Adenosintriphosphat_beschriftet.svg http://de.wikipedia.org/wiki/Bild:Adenosindiphosphat_protoniert.svg

 

ATP kann nun ein oder mehrere Phosphate abgeben. Bei jeder Abgabe wird für die Zelle Energie frei:

ATP > ADP + P + freiwerdende Energie (ΔH<0 – exotherme Reaktion)

Hier reagiert Adenosintriphosphat zur Adenosindiphosphat und Phosphat. Dabei wird Energie für die Zelle frei.

 

Denkbar ist auch die Abgabe von zwei Phosphaten:

ATP > AMP + PP + (deutlich mehr) freiwerdende Energie (ΔH<0 – exotherme Reaktion)

Obwohl ATP bei weitem der wichtigste Energieträger der Zelle ist, laufen entsprechende Vorgänge auch mit den anderen Basen ab! Die Stoffe sind dann entsprechend Guanosintriphosphat, Thymidintriphospaht sowie Cytidintriphosphat. Dies ist für das Verständnis der folgenden Seiten zum Thema Replikation wichtig!

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Adenosintriphosphat

http://de.wikipedia.org/wiki/Adenosindiphosphat

 

Tatsächlicher Ablauf der semikonservativen DNA-Replikation

Die DNA-Replikation ist ein semi-konservativer Vorgang, aus dem neue Komplementärstränge hervorgehen. Das Ziel der Replikation ist eine exakte Kopie des DNA- Strangs herzustellen. Die Replikation kann in drei Abschnitte unterteilt werden: Initiation - Elongation - Termination

 

a) Initiation

1. Nur bei Prokaryoten (Bakterien): Das Enzym Topoisomerase II (auch Gyrase bei Bakterien gennant) ist ein Enzym der Gruppe der Topoisomerasen und löst die Verdrillung der ringförmigen DNA - Vergleichbar mit zwei ringförmig geschlossenen Schnürsenkeln, die ineinader verdreht sind.
Die Topoisomerase II ist bei Pro- und Eukaryoten vorhanden. Bei Bakterien heißt sie nur Gyrase und ist minimal m Aufbau verschieden.

2. Entwindung und Auftrennung der DNA-Doppelhelix durch das Enzym Helicase an bestimmten Startpunkten, den Replikationsursprüngen (=Origin). Dies geschieht durch das Lösen von Wasserstoffbrückenbindungen. Man kann sich das evtl. wie eine verdrehte Strickleiter vorstellen, welche wieder zur Nutzung gerade gedreht wird. Dann wird diese reißverschlussartig geöffnet. Das entstehende Gebilde wird auch Replikationsgabel genannt.

3. Die Energie für diesen Vorgang kommt aus der Reaktion von zwei ATP, welche zu zwei ADP und 2 P reagieren. Damit sich die Stränge nicht sofort wieder schließen, indem sie neue Wasserstoffbrückenbindungen ausbilden, lagern sich „Einzelstrang-bindende Proteine“ (Single-Strand-Protein) an. Sie halten die Stränge voneinander fern.

4. Priming: Primasen (auch RNA-Polymerasen genannt) sind Enzyme, welche nun RNA-Primer (etwa 10 Nukleotide) als Startpunkt setzen.

 

b) Elongation

5. Anlagerung von komplementären Nukleotiden an den Originalstrang durch das Enzym DNA - Polymerase. Dieses Enzym arbeitet sich den Strang vom 3'-Ende zum 5'-Ende hoch. Chemisch gesehen ist dieser Vorgang eine Polymerisation. Als neue Bausteine dienen die Nukleotide, welche aus der jeweiligen Spaltung von ATP, TTP, GTP und CTP entstehen (diese müssen vorher frei im Zellplasma verfügbar sein!).
Dabei werden jeweils zwei Phosphate und viel Energie frei.

Bei diesem Spalten der Nucleosidtriphosphate wird Energie frei, die zur Verknüpfung der Nukleotide genutzt wird.
z.B.: ATP ---> AMP + PP

6. Die Nukleotide werden von der DNA-Polymerase III (der Aufbau geschieht also immer vom 5´-Ende in Richtung 3´-Ende) an den neuen DNA-Strang geknüpft. Dies geschieht ohne Unterbrechung bis zum Ende des Strangs oder bis zur Termination.

7. Ein „Problem“ ist, dass ein Strang immer antiparalell verläuft. (Man unterscheidet zwischen Leitstrang („leading strand“) und Folgestrang („lagging strand“) - der Strang an dem die DNA-Polymerase normal arbeitet, wird Leitstrang genannt - der andere Strang, an dem die DNA Polymerase in Bruchstücken arbeitet, wird auch als Folgestrang bezeichnet.).
Das bedeutet, dass die DNA-Polymerase am anderen Strang rückwärts arbeiten muss, dies tut sie immer für Abschnitte der Länge von ca. 1000 Basen und somit immer gegen bereits fertiggestellte Bereiche (bzw. andere DNA Polymerasen) stößt. Die Konsequenz ist, dass sie in diesem Fall dann die Synthese abbrechen muss. Folglich ist dann erneutes Priming notwendig!
Es entstehen folglich immer Einzelfragmente (zwischen den Primern), welche später zusammengefügt werden müssen. Diese Einzelfragmente werden Okazaki-Fragmente genannt. Die Replikation verläuft also semidiskontinuierlich. Ein Okazaki-Fragment ist ca. 1000 Nukleotide lang.

8. Diese Verbindung der entstehenden Fragmente geschieht durch das Enzym DNA-Ligase. Vorher müssen die ganzen Primer entfernt werden. Bei Bakterien erledigt dies die RNase H, bei Eukaryoten entfernt z.B. die Polymerase δ (auch Polymerase II genannt) die Primer (nicht ganz so wichtig!).

9. Das Korrekturlesen findet durch ein weiteres Enzym, die DNA-Reparatur-Polymerase.

10. Die Replikation findet in jede Richtung der Replikationsblase statt (=bidirektional).

 

c) Termination:

11. Die Termination muss oft nicht extra ausgelöst werden, da der DNA-Faden ja auch ein natürliches Ende hat.
Es gibt dennoch Terminationssequenzen (z.B. bei der ringförmigen DNA der Bakterien), welche das Signal für den Abbruch sind. Dazu gibt es Terminationsstellen, welche Bindeorte für das Protein Tus (terminus utilizing substance) sind. Dieses blockiert die Helicase, so das keine weitere Auftrennung mehr stattfindet.

Werkzeuge: Enzyme (Helicase, DNA-Polymerase, Ligase, DNA-Reparatur-Polymerase, Primase, bei Bakterien auch Gyrase)

Bausteine: Als Ausgangsmaterial und zur Energiebereitstellung müssen vorher bereitstehen:
ATP, GTP, CTP, TTP

Maximale Geschwindigkeit:

bei Bakterien: bis zu 40 000 Bp/min.

bei Eukaryoten: ca. 300 - 400 Bp/min (=> Dauer beim Menschen für das gesamte Erbgut ca. 9h)

 

DNA- Replikation im Schema

 

Merke: Die DNA wird immer vom 3’ zum 5’ von der DNA-Polymerase abgelesen und dann wird der neue komplementäre Strang immer in vom 5’ zum 3’ Ende gebildet!
Synthese der neuen DNA: oben kontinuierlich bzw. im unteren Strang diskontinuierlich (=> zuerst Bildung von Okazaki-Fragmenten, welche später zusammengefügt werden.)

 

Zeitpunkt der Replikation:

  • Bei Prokaryonten ist der Zeitpunkt nicht genau differenzierbar. Er steht in enger Verbindung mit der Zellteilung.
  • Bei Eukaryonten findet die DNA Replikation in der Mitose in der Synthesephase (S-Phase) des Zellzyklus statt (Bestandteil der sogenannten Interphase).

Mehrere Möglichkeiten der Replikation treten in der Natur auf:

  • rolling-circle-Prinzip (bei Bakterien) - z.B. beim Plasmidaustausch über Pili.
  • bidirektional (bei Eukaryonten): an beiden Replikationsgabeln wird gleichzeitig repliziert (also es wird in zwei Richtungen gearbeitet).
  • asymmetrisches Prinzip (nur bei Mitochondrien) (=D-Loop)

 

Aufgaben

1. Vervollständige: Zur identischen _______________ der DNA wird die ________________

 

durch das ___________ Helicase in ________________ aufgespalten.

 

An den Einzelsträngen lagern sich die _________________ Nukleotide an.

 

Es entstehen zwei identische __________________________ .

 

Die DNA wird dabei vom _____________ abgelesen und folglich der neue __________________

 

Strang immer in _____________ Richtung synthetisiert.

 

2. Ein Nukleotid ist ca. 0,28 nm lang. Ein für Menschen typischer DNA-Faden hat 8 Mrd. Nukleotid-­
paare. Wie lange ist dieser Faden? Wie passt der lange Faden in den kleinen Zellkern?

3. Berechnen Sie die Replikationsgeschwindigkeit in Basen pro Sekunde für die DNA von E. coli
(4,2 Mio Bp), wenn ein Replikationszyklus 30 Minuten dauert.

4. Wie heißen die kurzen Teilstücke am 3´-5-Strang?
5. Wie lässt sich bei der Reparatur entscheiden auf welchem Teilstrang der Fehler liegt?

6. Beschrifte die Zeichnung und erkläre dann Deinem Nachbarn den genauen Vorgang unter
Verwendung aller Fachbegriffe.

DNA Replikation - Lady Of Hats

Quelle Bild: Public domain by LadyofHats, Marina Ruiz; Gracias; https://commons.wikimedia.org/wiki/User:LadyofHats/gallery2#/media/File:DNA_replication_en.svg

 

Lösungen

1. Zur identischen Replikation der DNA wird die Doppelhelix durch das Enzym

Helicase in Einzelstränge aufgespalten (vergl. mit dem Öffnen eines Reißverschlusses).

An den Einzelsträngen lagern sich die komplementären Nukleotide an.

Es entstehen zwei identische DNA-Doppelstränge.

Die DNA wird dabei vom 3’ zum 5’ Ende abgelesen und folglich der neue komplementäre Strang immer in 5’ zu 3’ Richtung synthetisiert.

 

2. 2,2m

3. 2333 Bp/s

4. => Die DNA-Replikation verläuft bidirektional mit einer max. Geschwindigkeit von

40. 000 BP /min in jeder Richtung.

Info: Bei 108 Kopien eines E. coli Chromosoms wird nur mit 50 % Wahrscheinlichkeit ein Fehler gemacht! (Vgl. 1 Tippfehler auf 500.000 Schreibmaschinenseiten)

5. => Okazaki-Fragmente

6. => Markierung (Methylierung der Elternstränge)
Merke: „Die Eltern haben immer recht.“ *g*

DNA Replikation, beschriftete Skizze

Die DNA-Polymerase

Die Enzyme der DNA-Replikation stellt man sich oft als kugelartigen Körper vor. Tatsächlich liegt eine Proteintertiärstruktur zugrunde. Mithilfe von Röntgenuntersuchungen an kristalisierten Enzymen kann man folgende Struktur erkennen (gezeichznet!)

DNA Polymerase - Molekülstruktur, Tertiärstruktur eines Proteins

Quelle Bild: Creative Commons Attribution-Share Alike 3.0 Unported by Wikicommonsuser Yikrazuul - thank you; https://commons.wikimedia.org/wiki/File:DNA_polymerase.png


Eine Topoisomerase (zu der die Gyrase gehört) ist hier abgebildet:

http://de.wikipedia.org/wiki/Bild:Topoisomerase_II.png

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/DNA-Polymerase

http://de.wikipedia.org/wiki/Helicase

http://de.wikipedia.org/wiki/Replikation

http://de.wikipedia.org/wiki/Gyrase

http://de.wikipedia.org/wiki/Topoisomerase

http://de.wikipedia.org/wiki/Primer

 

Die Replikationsblase

Eine Besonderheit muss nun noch bedacht werden, um die Replikation ganz zu verstehen. Sie findet nicht nur an einem Ende des DNA Strangs statt, sondern oft an vielen. Dazu verfügt das menschliche Genom mit seinen ca. 3 Milliarden Basenpaaren über ca. 10000 Origins (Replikationsursprüngen).

Eine Replikation findet also nicht von einem DNA-Ende zum anderen statt, sondern beginnt an diesen Replikationsursprüngen. Von diesen wird in beide Richtungen des Stranges repliziert! Es bilden sich also nicht Y-Förmige Aufspaltungen, sondern vielmehr zwei sich gegenüberliegende Replikationsgabeln. Da dies wie eine Blase aussieht, spricht man auch von der Replikationsblase.

Merkmal der DNA-Replikation von Eukaryoten ist das Vorhandensein von mehreren Replikationsblasen gleichzeitig. So erfolgt bei der Fruchtfliege (Drosophila) die komplette DNA-Replikation (mit immerhin 62 Millionen Basenpaaren) in ca. drei Minuten! Dies ist nur möglich, da an ca. 6.000 Replikationsgabeln gleichzeitig repliziert wird.

Die Replikationsblase


schwarz: originale DNA

grün: neu gebildete DNA

Die Replikation verläuft von der Blase aus in beide Richtungen, also auch bei Eukaryoten! Die Blase wird dabei immer größer, bis sie an die Enden kommt und zweimal das gesamte Erbgut vorliegt.

 

DNA Replikationsunterschiede zwischen Pro- und Eukaryoten

 

Replikation bei Prokaryoten

Replikation bei Eukaryoten

Ablauf in der S-Phase der Mitose

 

Ringförmige DNA

Linearer DNA Strang

Eine Replikationsblase, welche größer wird

Mehrere Replikationsblasen, welche verschiedene Größen haben, da sie nicht alle zum gleichen Zeitpunkt beginnen.

Geschwindigkeit: 1000 Bp/s

=> E coli hat ca. 4,5 Millionen Bp und somit dauert die Replikation ca. 20 min.

Geschwindigkeit: 100 Bp/s

=> ca. 3 Milliarden Bp also dauert die Replikation ca. 9 Stunden.

 

 

Übung zur DNA Replikation

 

AUfgabe zur DNA Replikation

 

Die DNA-Polymerase

Die DNA-Polymerase (oder auch: DNA-abhängige DNA-Polymerase) ist ein Enzym, welches die Synthese von DNA aus Nucleosidtriphosphaten an einer DNA-Matrize katalysiert. DNA-Polymerasen spielen eine Schlüsselrolle bei der DNA-Replikation. Die DNA wird nicht aus Desoxyribonukleotiden synthetisiert, sondern aus Nucleosidtriphosphaten.

DNA-Polymerasen können nur an eine freie 3‘ Hydroxidgruppe (-OH) eines Zuckers ein weiteres Nukleotid anknüpfen. Dies geschieht über das Phosphat. Aus diesem Grunde entsteht eine neue Kette immer von 5‘ in 3‘ Richtung.

 

Polymerase-Aktivität

Die Polymerase hat die Aufgabe chemische Verknüpfungen von einzelnen Molekülen (Monomeren) zu einer Kette (Polymer) durchzuführen. DNA-Polymerase bildet als Polymer also die Desoxyribonukleinsäurekette (DNA). Die zur Verfügung stehenden Monomere sind dementsprechend die Nucleosidtriphosphate (genauer Desoxy-Nukleosidtriphosphate (dNTPs)).

Damit die DNA-Polymerase ihre Aufgabe erfüllen kann, nutzt sie stets den zur Verfügung stehenden „Elternstrang“ als Vorlage (Matrize) für die Synthese des neuen komplementären Stranges. Dies gelingt, indem immer komplementäre Basen an den Elternstrang gepaart werden. Die Verbindung geschieht dabei automatisch durch die Bildung von Wasserstoffbrückenbindungen.

Die Synthese des neuen DNA-Stranges erfolgt vom 5'- zum 3'-Ende!

Chemisch betrachtet, handelt es sich übrigens um einen nukleophilen Angriff, bei dem die endständige 3'-OH-Gruppe des DNA-Stranges das α-Phosphat des dNTPs angreift. Dabei wird Phosphat freigesetzt. Die Polymerase katalysiert diese nukleophile Substitution. RNA-Polymerasen benötigen im Vergleich zu DNA-Polymerasen kein freies 3'-OH Ende zur Synthese (an welche das erste freie Nukleotid angehängt wird).

Weiter hinten im Kapitel wirst Du die PCR kennenlernen. Auch dort werden Polymerasen verwendet. Diese nutzen einen 15-20 Nukleotide langen DNA-Einzelstrang als Startpunkt. Er wird auch Primer genannt.

 

Exonuklease-Aktivität

Die meisten Polymerasen verfügen über einer sehr wichtige Funktion. Sie überprüfen den neu gebildeten Strang mit der DNA-Matrize. Fällt bei diesem Korrekturlesen auf, dass Basen falsch ergänzt wurden, werden diese wieder entfernt.

Diese Fähigkeit wird als 3'->5'-Exonuklease-Aktivität bezeichnet.

Die Bedeutung der DNA-Polymerasen liegt im Durchführen der DNA-Replikation und der anschließenden Korrektur. DNA-Polymerasen sind somit in jedem Lebewesen zu finden.

 

Zusatzinformationen

http://de.wikipedia.org/wiki/RNA-Polymerase

 

Was sind Primer?

Primer sind Oligonukleotide (also kurze Abschnitte z.B. auf der DNA), welche als Startpunkt für DNA-replizierende Enzyme (z.B. der DNA-Polymerase) dienen.

Die DNA-Polymerasen ist auf das Vorhandensein einer Hydroxidgruppe (-OH) als Startpunkt für ihre erste Verknüpfungsreaktion angewiesen. Der stellt mit seinem 3’OH-Ende eine passende Hydroxidgruppe zur Verfügung.

 

Zusatzinformationen:

  • Primer können sowohl aus DNA als auch aus RNA bestehen. In Prokaryoten synthetisiert das Enzym Primase die für die Replikation notwendigen Primersequenzen.
    In Eukaryoten besitzt die DNA-Polymerase α eine eigene Primasefunktion.
  • Bei Eukaryoten entfernt z.B. die Polymerase δ die Primer
  • Ein besonderer Fall liegt an den Telomeren der eukaryotischen Zellen vor. Dem Enzymn zum Aufbau (Telomerase) dient das 3’OH-Ende der DNA als Primersequenz.
  • Nach der Replikation werden die Primer bei Prokaryoten z.B. durch die Polymerase I oder durch die RNAse H entfernt.
  • Primer haben eine wichtige Rolle bei der künstlichen DNA Sequenzierung im Labor. Bei der Polymerase-Kettenreaktion (PCR) werden z.B. auch Primer benötigt. Der Primer markiert hier sozusagen den Abschnitt auf der DNA, der künstlich im Labor repliziert werden soll.

Für die PCR verwendet man als Primer synthetisch hergestellte Nukleotidsequenzen, welche den zu replizierenden DNA-Abschnitt flankieren (einrahmen). Die PCR-Primer liegen genau zu den gewünschten Abschnitten passend vor. Sie sind, damit sie eindeutig nur an einer Stelle des Erbguts passen mindestens 18, meist 25-30 Basenpaare lang.

 

Was ist die Primase?

Die Primase ist ein Enzym (RNA-Polymerase), welches bei der Initiation (also dem Beginn) der Verdopplung des Erbmaterials eine Rolle spielt. Ihre Aufgabe ist das Erzeugen eines kurzen RNA-Startmoleküls (dem RNA-Primer).

Der gebildete Primer ergänzt sich komplementär zum Elternstrang. Er verwendet allerdings Uracil als Base und nicht Thymin. Dieses neu entstandene RNA-„Stückchen“ wird von der DNA-Polymerase als Ansatz- und Startstelle für die Verlängerung des DNA-Stranges genutzt.

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Primer

http://de.wikipedia.org/wiki/Primase

 

Gentechnik: Untersuchung von DNA

Für die medizinische Diagnostik, von Krankheiten, die Identifizierung von Krankheitserregern und für die kriminalistische Forschung ist die Analyse von DNA zu einem wesentlichen Werkzeug geworden. So werden heute, mit modernen Mitteln noch Verbrechen aus der Zeit von vor mehr als 20 Jahren aufgeklärt, da damals noch nicht die molekularbiologischen Möglichkeiten vorlagen.

Auf Biologen, welche als Evolutionsforscher das Alter bestimmter Tiere, bzw. deren Verwandtschaft untereinander bestimmen wollen, bedienen sich heute der Molekulargenetik.

Da man mit einzelnen DNA-Abschnitten nichts anfangen kann, müssen diese vor einer Untersuchung erst vervielfältigt werden. Dazu gibt es die Möglichkeit der Klonierung (durch Bakterien), was sehr aufwändig und teuer ist sowie die Möglichkeit der Polymerase Kettenreaktion (=PCR, Polymerase Chain Reaction). Im Anschluss an eine Vervielfältigung des Erbguts findet dann eine Gelelktrophorese statt, welche einzelne DNA-Abschnitte im elektrischen Feld auftrennt und identifizierbar macht.

 

Die Polymerase Kettenreaktion (=PCR)

Die PCR läuft im Grunde der normalen, natürlichen Replikation sehr ähnlich ab. Das Ziel ist es, im Labor aus einem oder wenigen Abschnitten, eine größere identische Menge herzustellen, so dass eine weitere Untersuchung mit dieser Probe durch z.B: Gelelektrophorese möglich ist. Die Methode stammt von Kary Mullis, welcher 1993 dafür den Nobelpreis erhielt .

Die PCR läuft in drei Stufen ab, die mehrfach wiederholt werden:

Denaturierung - Hybridisierung - Polymerisation

Die Reaktion wird ca. 25 - 35 mal wiederholt. Der PCR-Prozess wird in drei Schritten in einem so genannten Thermocycler in 30-50 Zyklen durch­geführt.

1. Denaturierung

Die Ursprungs-DNA (=Matrizen-DNA, Vorlage) wird auf ca. 90-100°C erhitzt. Dabei lösen sich die Wasserstoffbrückenbindungen der beiden komplementären Nukleotidstränge. Auch die natürlichen Primer trennen sich ab. Es entstehen DNA-Einzelstränge.

 

2. Hybridisierung (auch Primerhybridisierung genannt)

Das Gemisch wird auf 50-65°C abgekühlt (je nach verwendetem Primer!). Dabei gilt, dass die Temperatur unter den Schmelzpunkt des jeweiligen Primers abgesenkt werden muss.
=> Anlagerung der (dafür künstlich erzeugten) DNA-Primer an die einzelnen DNA-Stränge (zu hohe Temperaturen führen zur Anlagerung der Primer an die falschen Stellen).

 

3. Elongation (Verlängerung) (auch Polymerisation genannt) bei 72°C:

Vom Beginn des 3'-Ende des angelagerten Primers aus, beginnt nun eine DNA-Polymerase zu jedem Matrizen-DNA-Strang eine neue komplementäre Ergänzung aufzubauen. Es werden freie Nukleotide verwendet, welche vorliegen müssen. Dazu wird meist eine besondere taq-DNA-Polymerase (Ursprünglich gewonnen aus den hitzeliebenden Archaebakterium Thermus aquaticus, welches in heißen Quellen vorkommt. ) verwendet. Sie ist hitzestabiler als herkömmliche DNA-Polymerase. Ihr Temperaturoptimum liegt bei 72°C.

Die beiden neuen DNA Stränge dienen für den nächsten Zyklus nun auch als Vorlage
=> die DNA-Menge verdoppelt pro Zyklus.

Nach diesem ersten Zyklus finden in der Regel 20-30 weitere statt. Da der Vorgang zu einer exponentiellen Vermehrung führt, sind dann keine weiteren Vorgänge notwendig.

Beachte: Da die DNA-Polymerase vom 5‘ Ende zum 3‘ Ende synthetisiert, muss sie eine freie 3‘-OH-Gruppe zum Verknüpfen haben. Deswegen muss der Primer immer am 3‘ Ende eines DNA-Strangs angesetzt werden.

Bsp: 5‘-Ende Strang--------zu replizierender Bereich----------Ende Strang-3‘

5‘ G C A T T G---------------------------------------------------G C A T A G 3‘

3‘ C C T A T C 5‘ ← DNA-Primer

 

Ablauf der PCR

Ablauf der PCR

Quelle Bild: GNU Free Documentation License, Version 1.2 & Creative Commons Attribution ShareAlike license versions 2.5; http://creativecommons.org/licenses/by-sa/2.5/; http://commons.wikimedia.org/wiki/Image:PCR.svg

 

 

PCR-Ablauf

Ablauf der PCR (Skizze)

 

Vergleich von PCR und DNA-Replikation

PCR

DNA-Replikation

findet außerhalb der Zelle statt (in Vitro)

findet innerhalb von Zellen statt (in Vivo)

Findet statt, wenn im Thermocycler die passende Temperatur erreicht wurde und alle notwendigen Stoffe bereitstehen.

findet in der S-Phase des Zellzyklus statt

Künstlicher Vorgang bei verschiedenen Temperaturen, welcher in einem Thermocyyler durchgeführt wird.

Natürlicher Vorgang bei Körpertemperatur des jeweiligen Lebewesens, mit dem Ziel, Zellen zu vermehren und Erbgut zu reproduzieren.

DNA-Taq-Polymerase führt die komplementäre Ergänzung durch

Körpereigene DNA-Polymerase führt die komplementäre Ergänzung durch.

Taq-Polymerase aus Bakterien heißer Quellen ist hitzeunempfindlich und somit kann die Reaktion bei Temperaturen bis ca. 90°C stattfinden.

Bei Temperaturen >43°C ist die natürliche Replikation in der Regel nicht möglich. Bei allen Tieren und Pflanzen denaturieren ab dieser Temperatur die beteiligten Eiweiße/ Enzyme.

Zwei künstliche Primer werden nach Bedarf hergestellt und verwendet.

Die Primase synthetisiert passende Primer. Am Folgestrang liegen sehr viele verscheidene Primer vor.

Die Primer bestehen aus DNA-Nukleotiden.

Die Primer bestehen aus RNA-Nukleotiden.

Es wird nur ein Ausschnitt der DNA repliziert (Amplifikation).

Die DNA wird komplett repliziert.

Es werden viele hunderttausend Kopien erzeugt.

In der Regel wird nur eine DNA-Kopie erzeugt

Die Einzelstränge werden durch Hitze (Denaturierung) voneinander getrennt

Die Einzelstränge werden durch die DNA-Helicase voneinander getrennt.

Phasen: Initiation (Denaturierung) - Hybridisierung - Elongation (Polymerisation)

Phasen: Initiation – Elongation - Termination

Nur kontinuierliche Ergänzung und somit keine Okazaki-Fragmente

Kontinuierliche und diskontinuierliche Ergänzung an beiden Strängen

 

Korrektur durch DNA-Reparatur-Polymerase

Freie Nukleotidtriphosphate müssen vorliegen

Freie Nukleotidtriphosphate müssen vorliegen

Ergänzung erfolgt immer vom 3‘ zum 5‘-Ende

Replikation erfolgt immer vom 3‘ zum 5‘-Ende

 

 

 

Primer für die PCR

Wie unterschieden sich die Primer der PCR von den natürlichen Primern der Eukaryoten?

Da der Primer bestimmt, welcher DNA Abschnitt repliziert werden soll, ist er das wichtigste Werkzeug der PCR. Der synthetische Primer, ist also maßgeschneidert für eine bestimmte Sequenz, welche den Bereich markiert, der dahinter liegt und somit vervielfältigt werden soll.

Dazu werden zuerst Nukleotidsequenzen, die am Rande des zu vermehrenden Stranges liegen bestimmt und dann die entsprechenden Primersequenzen künstlich hergestellt. Diese synthetischen DNA-Primer enthalten in der Regel zwischen 18 und 30 Nukleotide. Diese synthetischen Primer werden zu Beginn zugegeben der PCR.

Wichtig: es liegen zwei verschiedene Primer vor, wovon einer, jeweils den gegenläufigen Strang zu seinem „Primerpartner“ repräsentiert.

Seit einigen Jahren kann man maßgeschneiderte Primer für spezielle gentechnische Anwendungen kaufen.

 

Welche PCR­-Primer sind wann geeignet?

Ein Primer muss so gewählt werden, dass er spezifisch genau an eine bestimmte Stelle bindet. Da das menschliche Genom aus ca. 3 Milliarden Basenpaaren besteht, muss also darauf geachtet werden, dass man eindeutige Primer, welche nur an eine einzige Stelle binden verwendet. Außerdem stellte sich heraus, dass die PCR besser abläuft, wenn der Primer am 3'­Ende mindestens zwei Basen hat, welche drei Wasserstoffbrückenbindungen ausbilden (also G oder C).

 

Weitere wichtige Kriterien zum Primerdesign

- beide Primer dürfen keinesfalls komplementär zueinander sein (=> sonst bilden sich Dimere!)

- beide Primer sollten eine ähnliche Schmelztemperatur haben (=> sonst ist keiner spezifische Hybridisierung beider Primer möglich)

- das 5'­-Ende des Primers darf nicht komplementär zum 3'-­Ende sein (=> sonst findet eine so genannte Haarnadel-­Bildung statt).

 

Länge des Primers und Wahrscheinlichkeit des Misspriming:

Für ein Dinukleotid gibt es bei 4 Basen 42 Kombinationsmöglichkeiten.

Für ein Trinukleotid gibt es bei 4 Basen 43 Kombinationsmöglichkeiten.

Statistisch ist so für ein Trinukleotid alle 43 = 64 Basen eine Hybridisierungsmöglichkeit gegeben.

 

Auf das menschliche Genom (3∙109 Nukleotiden) bezogen bedeutet dies: Ein Trinukleotid kann an 3∙109 ∙ 64-­1 = 4,6875∙107 Stellen hybridisieren!

 

Aufgaben:

1. Bestimme die Kombinationsmöglichkeiten und die Anzahl der möglichen Bindestellen im menschlichen Genom für folgende Primer:

a) Primer aus 8 Basen bestehend:

=> Kombinationsmöglichkeiten: 48 = 65536

=> mögliche Hybridisierungsstellen im menschlichen Genom: 45776

 

b) Primer aus 17 Basen bestehend:

=> bindet rein rechnerisch alle 417 = 17 179 869 184 bp.

=> mögliche Hybridisierungsstellen im menschlichen Genom: kleiner eins!!!

Schlussfolgerung: Ab einer Länge von 17 Nukleotiden ist ein Primer spezifisch, bezogen auf das menschliche Ge­nom.

 

Gelelektrophorese

Ist die PCR abgeschlossen, kann die vervielfältigte DNA bei ca. 4°C gut aufbewahrt werden. Im Anschluss findet in der Regel eine Gelelektrophorese statt, dazu wird die vervielfältigte DNA auf eine Gelplatte aufgetragen, an deren Ende sich der Plus- und Minuspol eines elektrischen Gleichstromkreises befinden. Die Gelplatte ist mit festem Agar bestrichen. Durch dessen Moleküle wirken wie ein bremsendes Geflecht, durch das die Moleküle hindurch müssen. Je kleiner sie sind, desto schneller gelingt ihnen dies und desto weiter können sie also wandern.

Gelelektrophorese: fertig replizierte DNA wird auf ein Gel, innerhalb eines Stromkreises aufgetragen und Gleichspannung angelegt. Es findet eine DNA-Aufspaltung statt.
Die kürzeren DNA-Stränge bewegen sich bei der Gelelektrophorese schneller als die langen. Beide wandern auf den Pluspol zu.

 

Aufgaben:

1. Warum können verschiedene Primer, bei gleicher Anzahl an Basen unterschiedliche Hybridisierungstemperaturen haben?

2. Was ist die Taq-Polymerase - und warum verwendet man sie?

3. Das Ergebnis einer DNA-Analyse lautet:

5'- A C T T A C T A G G A C T A G T T C T A G G A C T T T A C T A G G A C T T T A G C - 3'

Man möchte den fettgedruckten Bereich replizieren. Erstelle die beiden passenden Primer

4. Bei einer PCR wird folgende Matrizen-DNA verwendet.

5`ATG CCA-------------------------TAG GCA 3`
3`TAC GGT-------------------------ATC CGT 5`

a) Bestimme die notwendigen Primer.

b) Zeichne die jeweilige Laufrichtung der DNA Polymerase ein.

5. Bei der PCR trennt man die DNA durch Denaturierung in die beiden Einzelstränge. Warum verwendet man nicht „einfach“ das Enzym Helicase?

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Gelelektrophorese

 

Übersicht über die PCR Anwendungsgebiete:

  • Analyse alter (fossiler) DNA
  • Klonierung von Genen
  • Vaterschaftstest
  • Genetischer Fingerabdruck
  • Erkennung von Krankheiten
  • Mutagenese
  • Geschlechtsbestimmung

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Taq-Polymerase

http://de.wikipedia.org/wiki/Polymerase-Kettenreaktion

http://de.wikipedia.org/wiki/Primer

 

Primerhybridisierung

Als Primerhybridisierung (primer annealing) bezeichnet man den die Anlagerung eines Primers an DNA-Sequenzen.

 

Annealing­ und Schmelztemperatur (Tm)

Um eine gute und vollständige Hybridisierung zu erhalten, muss die richtige Hybridisierungstemperatur (Annealingtemperatur) vorliegen. Bei genau dieser Temperatur muss einerseits die Hybridisierung von Primer und Matrize stattfinden, andererseits darf es nicht zu fehlgepaarten Hybriden kommen, was bei zu hohen Temperaturen der Fall ist. Die ideale Temperatur kann man abschätzen indem man zuerst die Schmelztemperatur (Tm) des Hybrids aus Primer und Matrize feststellt und dann einfach 1-2°C darunter bleibt! So bilden sich nur die richtigen Verbindungen. Zu Berechnung von Tm kann folgende Formel verwendet werden:

Tm = 4 ∙ (G+C) + 2 ∙ (A+T) [°C]

 

PCR-Anwendungsgebiete I: PCR zur Aufklärung von Verbrechen

Die PCR ist heute ein wertvolles Hilfsmittel in der Kriminalistik. Sie dient als Beweismittel und hat schon so manchen Täter überführt.

Informiere Dich, wie der genetische Fingerabruck funktioniert und was er genau ist.:

http://de.wikipedia.org/wiki/Genetischer_Fingerabdruck

 

Aufgaben:

1. Was versteht man unter dem genetischen Fingerabdruck genau?

2. Kannst Du bestimmen, wer der Gärtner ist? ;-)

 

Genetischer Fingerabdruck

Eine praktische Anwendung der PCR ist die Ermittlung von Tätern. Hinterlassen diese am Tatort genetische Spuren, wie Blutzellen, Mundschleimhautzellen im Speichel an der Zigarette, Kleidung mit Hautzellen, verlorene Haare mit Haarwurzelzellen, Hautabriebzellen an einer Tatwaffe bzw. unter dem Fingenagel eines Opfers oder gar Spermienzellen, dann ist die eindeutige Zuordnung eines Täters (wenn man zum Beispiel eine DNA-Probe eines Verdächtigen entnimmt) zu dieser gefundenen DNA möglich.

Der so genannte genetische Fingerabdruck wird aber auch in der Lebensmittelindustrie verwendet. Gesundheitsämter können damit genaue Zuordnungen von verwendeten Fleischsorten zu den Herstellern und Bauern treffen. Steht z.B. auf einer Packung Putensalami und es befindet sich nur Schweinefleisch darin, hat der Produzent schnell ein Problem ;-)

Der genetische Fingerabdruck ist ein DNA-Profil und wird z.B. zur Identifikation von Personen eingesetzt, indem eine Probe DNA mit einer vorhandenen DNA-Probe verglichen wird.

Zur Untersuchung genügt theoretisch ein einziger DNA-Strang. Er kann z.B. aus den oben genannten Zelltypen gewonnen werden. Dazu wird im Reagenzglas von dem Enzym „Proteinase“ die Zellenmembranen und der Zellkern aufgelöst. Dabei wird die DNA freigesetzt und anschließend gereinigt. Diese wird wie üblich per PCR vervielfältigt und anschließend durch Gelelektrophorese getrennt. Das so gewonnene DNA-Profil wird auch als Fingerprinting bezeichnet. Alec Jeffreys entdeckte 1984 durch Zufall dieses Verfahren.

Die Besonderheit des Verfahrens liegt darin, dass nicht die einzelnen Gene der Personen untersucht werden, sondern Bereiche, welche KEINE Informationen enthalten und somit auch keine Proteine kodieren. Solche Bereiche werden auch Junk-DNA genannt. Die DNA eines Säugetiers enthält zu ca. 95% nichtinformative DNA.

Davon kommen zur Zeit 8-15 Abschnitte (= Loci (=Orte)) der DNA in Frage. Diese werden als Fragment mit Hilfe der PCR-Methode vervielfältigt. Das besondere an diesen Abschnitten ist, dass sie repetetiv sind - also aus kleinen, sich wiederholende Abschnitten bestehen. Diese tandemartige Wiederholungen einer bestimmten Sequenz (Repeats) kommen im Genom aller Säugetiere vor. Dabei unterscheidet man zwischen VNTR (variable number tandem repeats) - auch Minisatelliten genannt und STR (short tandem repeats). Diese VNTR/ Loci werden nach den Genen in ihrer Nähe benannt.

Beispiel eines solchen VNTR: TGGAGTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTGCCA

Wie man sieht, enthält der blaue Bereich eine Sequenz, die sich ständig wiederholt. Innerhalb einer Art, also z.B. bei allen Menschen, ist dabei die Anzahl der Wiederholungen variabel! Ein Mensch kann z.B. auf einem bestimmten Abschnitt auf einem Chromosom nur eine Wiederholung haben (z.B. vom Vater geerbt) und auf dem zweiten sieben Wiederholungen (von der Mutter geerbt). Nicht nur die Anzahl der Tandemwiederholungen, sondern auch deren Zusammensetzung variiert innerhalb der menschlichen Population. Die Basensequenzen aber, welche die Loci einrahmen, sind bei allen Lebewesen einer Art (also z.B. bei allen Menschen) gleich. Diese Anzahl der Wiederholungen wird bei dem genetischen Fingerabdruck nun untersucht. Dazu stellt man Primer her, die genau vor dem gewünschten Abschnitt andocken.

Bei der anschließenden Gelelktrophorese kann man anhand der Laufweite die Anzahl der Wiederholungen bestimmen. Je höher die Anzahl der Wiederholungen eines vervielfältigten Abschnittes ist, desto geringer ist die Laufweite. Bei den VNTRs ist der repetitive Anteil länger (10-150 Basenpaare) als bei den STR (2-7 Basenpaare).

DNA-Abschnitte mit wenigen Tandemwiederholungen laufen bei der Gelektrophorese weiter als die mit vielen Wiederholungen.

Wenn dieser Genort heterozygot ist, also wie oben schon erwähnt z.B. ein Mensch ein Allel mit einer und eines mit 6 Wiederholungen hat, dann sieht man später zwei Banden. Im Grunde wird also mit dem genetischen Fingerabdruck eine reine Fragmentlängen-Analyse durchgeführt. Dabei ist die Wahrscheinlichkeit, dass zwei Menschen an VNTR-Ort/Locus (oder einem STR-Ort) eine unterschiedliche Anzahl von Wiederholungen haben, schon sehr hoch!

Untersucht man dann mehrere dieser Loci, so ergibt sich in der anschließenden Gelelektrophorese ein Bandenprofil. Nun kann eine Aussage zur generellen Häufigkeit dieses Profils in der Gesamtpopulation bzw. der untersuchten Gruppe getroffen werden. Da die untersuchten Bereiche keine tatsächlichen Informationen enthalten und für keine Enzyme codieren, können Sie auch keine Informationen über individuelle Stärken oder Schwächen des Individums enthalten, so das datenschutzrechtliche Bedenken hier unangebracht sind. Eine genauere Methode zur DNA-Untersuchung ist die DNA-Sequenzierung. Dabei wird das Erbgut Base für Base ausgelesen. Diese Methode ist deutlich aufwändiger.

Aufgaben:

1. Was ist eine Pute?

2. Beschreibe mit eigenen Worten, wie man einen genetischen Fingerabdruck gewinnen kann.

3. Ist durch das Verfahren wirklich ein 100%iger Datenschutz und Anonymität gegeben? Diskutiere und bewerte diesen Aspekt

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Genetischer_Fingerabdruck

 

DNA-Sequenzierung (nach Sanger)

Die DNA-Sequenzierung ist eine Methode zur Bestimmung einer DNA-Sequenz, d.h. der Abfolge der Basen (Nukleotide) in einem DNA-Strang. Sie gilt als eine der wichtigsten Untersuchungsmethoden der DNA überhaupt. Von 1995- 2005 konnte so das Genom von über 300 Organismen analysiert werden. Dazu gehört auch das menschlichen Genom (mit mehreren Milliarden Basenpaare).

DNA Sequenzierung nach Sanger im Schema

 

Man kennt heute verschiedene Verfahren. Eines der wichtigsten ist die Kettenabbruch-Synthese (=Didesoxymethode) nach Sanger, bei der kurze DNA-Abschnitte (engl. reads) von weniger als 1000 Basenpaaren untersucht werden. Um also das Genom eines ganzen Lebewesens zu sequenzieren ist viel Zeit und Teamwork notwendig. Sanger entwickelte sein enzymatische Methode zur Sequenzierung 1975-1977 dar. Er erhielt dafür zusammen mit Gilbert 1980 den Nobelpreis für Chemie. Hut ab!

Die zu untersuchende DNA muss zuerst denaturiert werden (also in Einzelstränge zerlegt werden) und
einen bekannten Abschnitt haben, an den ein radioaktiv markierter Primer angelagert wird.
Durch Zugabe des Enzyms DNA-Polymerase werden an die komplementären DNA-Stränge wieder ergänzt. Der Unterschied zum normalen Vorgang ist, dass im Reaktionsgefäß nicht nur die üblichen Desoxynukleotid-Triphosphate (dATP, dTTP, dCTP, dGTP) vorliegen müssen, welche ja den DNA Strang wieder komplettieren, sondern zusätzlich jeweils eine besondere Nukleotidsorte.

Diesen besonderen Nukleotiden (di-deoxy-Nukleotide - ddATP, ddTTP, ddCTP, ddGTP) fehlt am dritten Kohlenstoff des Zuckers der Sauerstoff und der Wasserstoff (also liegt keine Hydroxygruppe vor), so dass sie kein weiteres Nukelotid mehr binden können. Die Folge ist ein Kettenabbruch. Die DNA-Polymerase kann hier nicht mehr weiterverknüpfen. Diese Nukleotide werden deshalb auch Abbruchnukleotide genannt. Es wird pro Ansatz immer nur eine Sorte (in geringen Konzentrationen (ddNTP : dNTP ca. 1:100) zugegeben.

So ergibt sich eine Wahrscheinlichkeit, dass die DNA- Polymerase immer wieder mal ein ddNTP anstelle eines dNTPs erwischt und einbaut. Der Einbau der Abbruchnukleotide in den neusynthetisierten Strang führt zum Entstehen von DNA-Fragmente unterschiedlicher Länge (da alles ja am DNA-Strang mehrfach abläuft), die aber immer mit dem jeweilig zugefügten Abbruchnukleotid enden. Nun wird die jeweilige Lösung mittels Gelelektrophorese nach der Länge der DNA-Fragmente aufgetrennt. Kurze Fragmente laufen dabei weiter als lange. Der Vergleich der vier Ansätze mittels Gelelektrophorese ermöglicht nun das Ablesen der DNA-Sequenz.

Anstelle der radioaktiven Primer kann man auch die Abbruchnukleotide markieren. Dies geschieht durch Fluoreszenzfarbstoffe.

 

Aufgaben zur Gensequenzierung:

Mit dem Primer „ATGCGA“ wird eine DNA-Sequenzierung gestartet. Eine anschließende Gelelektrophorese zeigt folgendes Bild. Wie lautet die DNA-Sequenz?

Aufgaben zur DNAsequenzierung

 

2. Wird bei einer DNA-Sequenzierung nur ein oder werden beide Stränge untersucht? Wie wird das gesteuert?

 

3. Erkläre anhand der Grafik, wie man zu dem Ergebnis der Sequenzierung kommt.

DNA Sequenzierung

Quelle Bild: PD, bzw. evtl. GNU-Lizenz für freie Dokumentation 1.2 von Wikipediauser C.Goemans- Danke; http://de.wikipedia.org/wiki/Bild:Didesoxymethode.png

Zusatzinformationen:

http://de.wikipedia.org/wiki/DNA-Sequenzierung

 

Übersicht DNA-Sequenzierung nach Sanger

 

DNA Sequenzierung - Laborergebnis

DNA Sequenzierung nach Sanger

Quelle Bild1: GNU Free Documentation License, Version 1.2 & Creative Commons Attribution ShareAlike license versions 2.5; http://creativecommons.org/licenses/by-sa/2.5/; http://commons.wikimedia.org/wiki/Image:Radioactive_Fluorescent_Seq.jpg

Quelle Bild2: Quelle Bild: GNU Free Documentation License, Version 1.2 & cc-by-nc-sa (http://en.wikipedia.org/wiki/Creative_Commons) by Wikicommonsuser John Schmid; http://commons.wikimedia.org/wiki/Image:Sequencing.jpg

 

DNA Hybridisierung

Unter Hybridisierung versteht man die Anlagerung eines (mehr oder weniger vollständig komplementäreren DNA- bzw. RNA-) Einzelstrangs an einen anderen DNA/ RNA-Einzelstrang.

 

Dies geschieht unter Ausbildung von Wasserstoffbrückenbindungen zwischen den jeweils komplementären Nukleinbasen.

Die Hybridisierungstechnik wird unter anderem für folgende Zwecke verwendet:

  • Nachweis der strukturellen Verwandtschaft von Nukleinsäuren
  • PCR
  • Gensequenzierung: Dabei gilt: je höher der Anteil an korrekten komplementären Basenpaarungen in einem DNA-Hybrid ist, desto höher ist die Temperatur, welche für die Trennung in Einzelstränge notwendig ist (da ja mehr Wasserstoffbrücken ausgebildet sind und so die Stränge fester zusammenhalten). Es gilt die Faustregel: Eine Abweichung von 1°C entspricht ca. 1,3% ungepaarter Basen.
  • Isolierung von spezifischer Nukleinsäuresequenzen aus einem Gemisch

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Hybridisierung_(Molekularbiologie)

 

Unterschiede von RNA und DNA I

  • Ribose statt Desoxyribose als Zucker
  • RNA ist meist nur ein Einzelstrang
  • m-RNA ist viel kürzer (nur 1 Gen)
  • Statt Thymin wird Uracil als Base verwendet

 

Problem: Welcher Einzel-Strang wird abgeschrieben?

Ähnlich der Replikation wird die DNA Doppelhelix lokal aufgewunden. Es erfolgt eine Strangtrennung. An einem der beiden DNA-Stränge lagern sich komplementäre Ribonukleotide an. Diese werden durch die RNA-Polymerase miteinander verknüpft:.

- Entwindung der DNA-Doppelhelix.

- Strangtrennung.

- Anlagerung von freien Ribonukleosidtriphosphaten an den codogenen-Strang.

- Verknüpfung durch RNA-Polymerase (von 5´nach 3´).

- Erhalt eines RNA-Einzelstranges.

 

Aufgaben zu den Unterschieden von DNA & RNA

1. Ca. 99% des genetischen Codes der DNA codieren m-RNA! In Zellen findet man aber nur ca. 1% mRNA. Man findet prozentual mehr rRNA und tRNA. Welche Ursachen und welche Auswirkungen (Vorteile) hat dies für die Zelle?

2. Die Endosymbiotenhypothese vermutet, dass Zellorganellen wie Mitochondrien und Chloroplasten dadurch entstanden sind, dass sie vor Milliarden von Jahren als Bakterien von anderen Zellen durch Endocytese aufgenommen und nicht verdaut wurden. In ihren Wirten haben sie ein weiteres eigenständiges Leben geführt. Welche heute bekannte Tatsachen stützen diese Theorie?

Zusatzinformationen

  • Bei bestimmten Viren findet eine Umkehrung der Transkription statt.
  • Die so genannten Retroviren besitzen eine Reverse Transkriptase, mit der sie ihre RNA (genetische Information) in DNA umschreiben können.
    (normale Zellen lesen von DNA ab --> Virus stellt sein Überleben sicher und benutzt Transkriptase des Wirts)  Die Viren-DNA wird von den Zellenzymen repliziert (z.B. HI-Virus)

 

DNA und RNA im Vergleich

 

DNA

RNA

 

ohne Sauerstoff am 2. Kohlenstoff

 

mit Sauerstoff am 2. Kohlenstoff

Zucker: Desoxyribose

Zucker: Ribose

Basenpaare: G≡C

A=T

Basenpaare: G≡C

A=U

Doppelstrang

In der Regel nur ein Einfachstrang

langkettig

kurzkettig

viele Gene

wenige Gene (wenn überhaupt)

Funktion / Aufgabe

Informationsspeicher

Matrize für RNA-Synthese

v.a. Informationsüberträger

m-RNA: Code-Transport
(messenger-RNA)

r-RNA: Gerüstsubstanz des Ribosoms
(ribosomale-RNA)

t-RNA: AS-Übertragung
(transfer-RNA)

Nur die RNA-Viren (häufigste Virenart) nutzt RNA anstelle der DNA als Speichermedium

Vorkommen

- Zellkern

- Mitochondrien

- Chloroplasten

- Ribosomen

- Cytoplasma

- Zellkern

Sonstiges

 

m-RNA ist kurz - oft nur nur 1 Gen lang

RNA Doppelstränge sind möglich - sie ähneln dann der DNA-Doppel-Helix (antiparallele Anordnung und rechtsgewunden)

 

Verhältnis der verschiedenen RNA-Typen (bei E.coli):

% DNA % in Zelle

r-RNA 0,5 % 80 %

t-RNA 0,2 % 10 %

m-RNA 99 % 1-2%

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/RNA

http://de.wikipedia.org/wiki/MRNA

http://de.wikipedia.org/wiki/Ribosomale_RNA

http://de.wikipedia.org/wiki/TRNA

http://de.wikipedia.org/wiki/Bild:RNA-comparedto-DNA.PNG (schönes Bild)

 

Vom Gen zum Merkmal

Ein Gen ist eine Funktionseinheit der DNA. Es gibt vor, wie ein bestimmtes genetisch bedingtes Merkmal (beispielsweise der Farbstoff einer Blüte), aufgebaut wird.

Als Gen bezeichnet man einen festen Abschnitt der DNA, der genau für die Ausbildung eines Proteins (also demzufolge eines Merkmals, einer Information oder eines Enzyms) codiert.

Die Individualität des Einzelnen ist durch seine Gene festgelegt, aber erst durch die daraus gebildeten Eiweiße (=Proteine) wird sie auch tatsächlich umgesetzt.

 

Zum besseren Verständnis wird eine Wiederholung des Kapitels 08.13 „Enzyme und Proteine“ empfohlen.

 

Aufbau der Proteine

Bestandteile der Zelle: 70-80 % Wasser
15-20 % Proteine

Funktion: - Baustoff => Körperwachstum

- Wirkstoff => Enzyme / Hormone (z.B. Insulin)

 

Chemische Zusammensetzung der Aminosäuren (und somit der Proteine): C, H, O, N, S

Proteine sind aus Aminosäuren aufgebaut, welche in der Regel nicht als
Eiweißfaden (Primärstruktur), sondern in einer bestimmten räumlich
gefalteten Struktur (Sekundär- bzw. Tertiärstruktur) vorliegen.

In Enzymen sind in der Regel mehrere Proteine zu einer Quartärstruktur verbunden.

Bedenke: Im Gegensatz zu Vitaminen und Mineralsalzen, können Eiweiße nicht durch die Nahrung aufgenommen und direkt vom Körper verwendet werden. Schon beim Kontakt mit der Magensäure denaturieren sie irreversibel.

Im Verlauf der Verdauung, werden Proteine von Verdauungsenzymen (v.a. im Darm) in Aminosäuren zersetzt. diese gelangen von der Darmwand ins Blut und zu den weiteren Körperzellen. Sind sie einmal im Zellplasma angekommen, werden sie dort zwischengelagert und stehen für die Ribosomen zu späteren Verwendung zur Verfügung.

Zusatzinformationen:

http://de.wikipedia.org/wiki/Enzym

 

a) Grundbausteine der Proteine: die Aminosäuren (AS)

Zur Proteinbildung sind 23 verschiedene AS (die sich nur im Rest R unterscheiden) bekannt. 20+1 werden dabei vom Menschen genutzt. Man kennt aber mittlerweile ca. 250 AS, die aber nicht zum Aufbau von Proteinen genutzt werden.

Aufbau einer Aminosäure

 

Oligopeptide (2-10 AS)

2 AS => Dipeptid

3 AS => Tripeptid

 

Polypeptide (>10 AS)

Makropeptide (> 100 AS)

noch mehr AS => Proteine

 

Die Peptidbindung:

Die Peptidbindung

Der Einfachheit halber sind in dieser Grafik (und auch in den oberen, die AS linear dargestellt. Bei einer 100%ig korrekten Darstellung müsste die NH2-Gruppe allerdings nach oben zeigen.

Quelle Bild: Public domain by Wikicommonsuser YassineMrabet - Thank you; http://commons.wikimedia.org/wiki/Image:Peptidformationball.svg

 

c) Struktur der Proteine

Bei 2 AS => es gibt 2 Möglichkeiten der Verknüpfungen! (Gly - Arg oder Arg - Gly)

=> primäres Problem ist die AS-Sequenz, d.h. bei einer Anzahl n an verschiedenen AS

=> 23n mögliche Proteine (beim Menschen 20n bzw. 21n)

 

1. Primärstruktur

Die Primärstruktur ist die reine Abfolge der AS-Bausteine (=AS-Sequenz)

2. Sekundärstruktur

Sie bezeichnet die räumliche Anordnung der AS-Sequenz als:

- α-Helix oder - β-Faltblatt

3. Tertiärstruktur

Durch Disulfid-Brücken und andere Wechselwirkungen kommt es zu einer dreidimensionalen Anordnung der Helix- bzw. Faltblattabschnitte => „Proteinknäul“

4. Quartärstruktur

Die Zusammenlagerung mehrerer Peptidketten zu einer biologisch wirksamen Einheit (=Enzym). (z.B. 4 Untereinheiten im Enzym des Hämoglobins - vgl. Briefmarkenblock)

 

Störungen und Zerstörungen

  • Bei Temperaturen von über 60°C kommt es zur Zerstörung der Disulfidbrücken und der hydrophoben Wechselwirkungen => das Enzym ist denaturiert und unwirksam.
  • Beim Kochen wird die Tertiär- und Quartärstruktur zerstört. Eiweiß gerinnt, fällt aus.
  • Bei Fieber über 42 °C wird die Funktion der Enzyme gestört.
  • Weitere Möglichkeiten der Proteindenaturierung: Kochen, Alkohol, Schwermetalle, Dauerwelle

 

Übersicht über die vier Proteinstrukturebenen:

Proteinstrukturen - primärstruktur, Sekundärstruktur, Tertiärstruktur, Quartärstruktur

Quelle Bild: Public domain by Wikicommonsuser LadyofHats, Marina Ruiz; Muchas gracias! https://commons.wikimedia.org/wiki/File:Main_protein_structure_levels_uk.svg

 

Aufgaben:

1. Bestimme aus einer Grafik die Anzahl an Helixabschnitte im Myoglobin.

2. Erkundige Dich, was eine Dauerwelle mit Disulfidbrücken zu tun hat

 

d) Wechselwirkung innerhalb eines Proteins

 

Wechselwirkung

Stabilisierung

Wasserstoffbrücken

Sekundärstruktur

Ionische WW
Disulfidbrücken
unpolare WW


Tertiärstruktur

 

e) Bedeutung von Proteinen

  • Enzyme (Hormone)
  • Strukturproteine (Bsp. Membranproteine = Corrin, Kollagen)
  • kontraktile Proteine ermöglichen Muskelkontraktion (Actin, Myosin)
  • biologisches Leben ist ohne Proteine und Enzyme nicht möglich
  • Transportproteine (z.B. im Hämoglobin)
  • Schutzproteine (z.B. Antikörper => Immunsystem)
  • Speicherproteine (Ferritin in Leber)
  • Toxine (Pilzgifte, Schlangengifte)

Für die selbstständig ablaufende Faltung eines Proteins („self-assembly“)
zur Tertiärstruktur ist allein die Primärstruktur verantwortlich.
Die Tertiärstruktur entscheidet über Funktion und Spezifität eines Proteins.

Beachte: Auf der DNA sind lediglich AS-Sequenzen verschlüsselt.

 

Beispiele für Peptide:

  • Neuropeptide des ZNS
    z.B. Endorphine, welches als Neurotransmitter an Rezeptoren bindet und so Schmerzsignale unterdrücken kann. An die gleichen Rezeptoren bindet auch das Schmerzmittel Morphin.

  • Peptidhormone (bestehend aus 3-84 AS)
    - Insulin (Hormon zur Steuerung des Blutzuckerhaushalts)
    - Proinsulin
    - FSH (weibliches Zyklushormon)
    - LH (weibliches Zyklushormon)
    - Glycagon
  • Peptid-Antibiotika
    Penicillin

  • Gifte (Toxine)
    - Amanitin (Gift des Knollenblätterpilzes)
    - Bienengift (Gemisch aus mehreren Peptiden)
    - viele Schlangengifte

 

f) Einteilung der Proteine (nur LK)

1. Skleroproteine
im Wasser unlöslich
besitzen Faserstruktur
dienen als Stütz- und Gerüstsubstanzen
Kollagene (Bindegewebe), Keratine (Haare, Nägel, Federn)

2. Spiroproteine (Globuläre Proteine)
im Wasser oder verdünnter Salzlösung löslich
Spiroproteine sind sphärische Moleküle
Proteine des Blutserums, Eiklarproteine, die meisten Enzyme

3. Proteide
Komplexe aus Proteinanteil und einer nicht proteinartigen prosthetischen Gruppe
Glycoproteine
Lipoproteine
Phosphorproteine
Metallproteine

 

Aufgaben:

1. Wie werden Proteine im Körper überall synthetisiert?

2. Welche Funktion haben die Ribosomen bei der Proteinbiosynthese?

 

g) Zum Vergleich - Proteide

Proteide sind zusammengesetzt aus einem Proteinanteil (Eiweißanteil) und andere Bestandteilen (Nichteiweißanteile). Diese anderen Bestandteile können Zucker (dann hat man ein Glykoprotein), Fette ( dann hat man ein Lipoprotein) oder Nucleinsäuren (dann hat man ein Nucleoprotein) sein. Der Nichteiweißanteil des Moleküls bestimmt maßgeblich dessen biologische und chemische Funktion. Er wird deshalb auch als prosthetische Gruppe bezeichnet.(z.B. Häm in Cytochromen wie dem Hämoglobin).

 

Proteide sind für biologische Vorgänge von entscheidender Bedeutung:

Nucleoproteide - sie bestehen aus einem Proteinanteil und einer Nucleinsäure

Lipoproteide - bestehen aus einem Proteinanteil und einem Lipid (Fett)

Phosphoproteide: - bestehen aus einem Proteinanteil und Phosphat (bzw. Phosphorsäure), z.B. das Casein, welches zur Käseherstellung dient

Glykoproteide - bestehen aus einem Proteinanteil und Kohlenhydraten, z.B. Lysozym - in der Tränenflüssigkeit)

Chromoproteide - bestehen aus einem Proteinanteil und einem Farbstoff bzw. einem Metallion
z.B. o Häm im Hämoglobin, dem roten Blutfarbstoff, dient dem Sauerstofftransport)

o Myoglobin für die Sauerstoffspeicherung

o das Cytochrom c für den Elektronentransport in der Photosynthese

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Proteide

 

Systematik der Proteine geordnet nach deren Funktion

  • Hormone (z.B. Peptidhormone der Hypophyse)
  • Schutzproteine und Schutzenzyme (z.B. Lysozym aus dem Schweiß zersetzt Bakterienwände)
  • Leberproteine
  • Oberflächenproteine
  • Transportproteine
  • Kontraktile Proteine (Actin & Myosin - zu finden in Muskeln)
  • weitere integrale Zellmembranproteine
  • Speicherproteine
  • Enzyme (Biokatalysatoren)
  • Toxine (z.B. Schlangengifte)

 

Ein Vergleich: Wie viele AS-Kombinationsmöglichkeiten gibt es?

Polypeptid aus 100AS => 20100 Kombinationsmöglichkeiten

Zum Vergleich:

H2O Moleküle in den Weltmeeren der Erde: 1046

Teilchen im Universum (nach einer Schätzung von A. Einstein): 1076

 

Die Aminosäuren (=AS)

Aminosäuren werden vom Körper zum Aufbau von Proteinen verwendet. Diese sind als Enzyme z.B. an allen Stoffwechselvorgängen des Körpers beteiligt. 20 Aminosäuren sowie Selenocystein kommen in menschlichen Eiweißen vor. Davon müssen 12 AS in Form von Eiweißen mit der Nahrung aufgenommen bzw. vom Körper produziert (Dies kann auch von Darmbakterien geschehen) oder aus anderen AS umgewandelt werden. So kann beispielsweise Methionin aus Cystein synthetisiert werden. Die restlichen 8 Aminosäuren heißen auch essentielle AS, da sie über die Nahrung aufgenommen werden müssen (Isoleucin, Leucin, Lysin, Methionin, Phenylalanin, Threonin, Tryptophan, Valin). Fehlen Sie, z.B. bei Mangelernährung, einseitiger Ernährung oder Nahrungsmittelallergien), so können bestimmte Proteine nicht gebildet werden, was zur Folge hat, das die entsprechenden Stoffwechselvorgänge nicht funktionierenden.

Die AS Tyrosin wird erst bei erwachsenen Menschen gebildet. Aus diesem Grunde ist sie für Kinder essentiell. Sie muss Bestandteil der Nahrung sein.

 

Übersicht über die 20+2 Aminosäuren

L-Alanin Ala

L-Arginin Arg

L-Asparagin Asn

L-Asparaginsäure Asp

L-Cystein Cys

L-Glutamin Gln

L-Glutaminsäure Glu

Glycin Gly

L-Histidin His

L-Isoleucin Ile

L-Leucin Leu

L-Lysin Lys

L-Methionin Met

L-Phenylalanin Phe

L-Prolin Pro

L-Selenocystein Sec

L-Serin Ser

L-Threonin Thr

L-Tryptophan Trp

L-Tyrosin Tyr

L-Valin Val

 

L-Pyrrolysin Pyl - kommt im Menschen nicht natürlich vor

L-Selenomethionin SeMet - kommt im Menschen nicht natürlich vor

Für weitere Informationen bitte zuerst Kapitel 08.13 Aminosäuren und Eiweiße lesen!

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Aminosäuren

Übersicht über die im Menschen vorkommenden Aminosäuren

Quelle Bild: GNU Free Documentation License, (http://en.wikipedia.org/wiki/GNU_Free_Documentation_License) & Creative Commons Attribution-Share Alike 3.0 Unported license (http://creativecommons.org/licenses/by-sa/3.0/deed.en) by Wikicommonsuser MarkusZI; http://commons.wikimedia.org/wiki/File:Aminosaeuren.png

 

 

Übersicht über die essentiellen Aminosäuren

 

Essentiell

Können vom Körper synthetisiert werden

Isoleucin

Alanin

Leucin

Asparagin

Lysin

Aspartat

Methionin

Cystein

Phenylalanin

Glutamat

Threonin

Glutamin

Tryptophan

Glycin

Valin

Prolin

 

Serin

 

Tyrosin

 

Arginin

 

Histidin

 

Übersicht über die Proteinbiosynthese: „Vom Gen zum Protein“

Die Proteinbiosynthese (griech. proteos = von äußerster Wichtigkeit) ist der Vorgang in jeder Zelle, der für die Herstellung von Eiweißen (=Proteine) verantwortlich ist. Er startet im Zellkern und findet dann in den Ribosomen statt.

Proteine bestehen aus Ketten von Aminosäuren. Die Länge der Aminosäureketten reicht von 2 bis über weit 1000 Aminosäuren (Titin, das größte bekannte menschliche Protein, besteht aus über 30.000 Aminosäuren). Die Zusammensetzung und der Aufbau eines Proteins sind im Erbgut des jeweiligen Lebewesens kodiert. Mit Hilfe dieses Bauplans können die Ribosomen einer Zelle Proteine produzieren. Verschiedene Proteine unterscheiden sich in der Abfolge ihrer AS-Sequenzen.

 

Die Proteinbiosynthese gliedert sich in zwei Phasen:

a) Transkription:

Umschreiben von DNA in Messenger-RNA (=Abschrift der DNA), der beweglichen Form des Erbguts. Die m-RNA wird mit Hilfe des Endoplasmatischen Reticulums zu den Ribosomen befördert. Ribosomen könne hunderttausendfach in Zellen auftreten.

b) Translation:

In diesem Schritt wird die angelieferte RNA-Information in den Ribosomen in eine Aminosäurekettensequenz übersetzt. Die AS werden untereinander verbunden.

 

Transkription und Translation von Alkoholdehydrogenase in der Übersicht

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Alkoholdehydrogenase

http://de.wikipedia.org/wiki/Ethanol

 

Ort der Proteinbiosynthese

Die Ribosomen sind Ort des zweiten Teils der Proteinbiosynthese. Dazu benötigen sie andere Stoffe zur Hilfe (Nukleotidsequenzen mit Basen, tRNA). Die genetische Information sitzt aber im Erbgut des Zellkerns. Wie gelangt die Information zu den Ribosomen?

Es wird ein Bote eingesetzt, ein „Messenger“ (m-RNA). Damit dem Zellkern keine
Informationen verloren gehen, muss genetische Information abgeschrieben werden.
Die RNA ist das Transportmolekül der genetischen Information.
Die DNA einer Zelle enthält viele Gene. Nur benötigte Gene werden
abgeschrieben“ (=transkribiert).

 

Vorteile der Herstellung einer Kopie:

  • mehrere Kopien der DNA können gebildet werden => die Synthese ist an vielen Ribosomen möglich
  • Es entsteht die Kopie eines einzelnen Gens („handlich“ für die Zelle)
  • Die Information wird transportabel (vgl. Virus, Gentechnik)
  • gezielte Ausprägung/ Aktivierung einzelner Gene und somit Eigenschaften ist möglich
  • Die Kopien können ohne Verluste an wichtigem Erbgut abgebaut werden

 

Die Proteinbiosynthese bei Eukaryonten I: Transkription:

Sie findet bei Eukaryoten (Zellen mit Zellkern) im Zellkern statt, bei Prokaryoten (z.B. Bakterien) schwimmt die DNA frei im Zellplasma. Also findet die Transkription dort im Cytoplasma statt (oft auch zeitgleich mit der Translation).Die Transkription ist der Vorgang des Abschreibens der DNA zu mRNA. Dabei werden die Nukleotidsequenzen der DNA zu neu gebildeten RNA-Ketten kopiert.

Transkription: = Überschreiben der Basensequenz der DNA in die messenger-RNA

 

Ablauf in der Übersicht:

Dazu wird die DNA entspiralisiert (durch Bindung einer RNA-Polymerase an einen Promotor wird der DNA-Strang entspiralisiert). Dann wird die Information der DNA durch das Enzym RNA-Polymerase in mRNA (messenger-RNA bzw. Boten-RNA) umgeschrieben. Dazu wird die DNA Doppelhelix kurzzeitig geöffnet und mit passenden, komplementären RNA-Nukleotiden ergänzt. Die reife mRNA wird dann durch aktiven Transport aus dem Zellkern zu den Ribosomen transportiert.

 

Ablauf der Transkription im Detail:

Zuerst bindet das Enzym RNA-Polymerase an Startstelle der DNA

Initiation: Das Enzym RNA-Polymerase bindet an DNA und gleitet an ihr (von 3’zu 5’-Richtung) entlang bis sie einen Promoterbereich findet. Es kommt zur Bildung eines Promotorbereichs zwischen Polymerase und DNA, was zum Lösen der Wasserstoffbrückenbindungen zwischen den Basen führt. Es entsteht ein offener Promotorkomplex.
=> die RNA-Polymerase liest nur den Matrizenstrang (=codogener Strang) ab! Beachte: Die RNA-Polymerase benötigt keinen Primer

Elongation: Das Enzym RNA-Polymerase bindet an DNA und gleitet an ihr (von 3’ zu 5’-Richtung) entlang bis sie einen Promoterbereich findet. Zwischen Polymerase und DNA entsteht ein offener Promotorkomplex, was zum Lösen der Wasserstoffbrückenbindungen zwischen den Basen führt.
=> die RNA-Polymerase liest nur den Matrizenstrang (=codogener Strang) ab! Beachte: Die RNA-Polymerase benötigt keinen Primer.

Promotor: Der Promotor ist eine bestimmte Nukleotid-Sequenz auf der DNA. Er ist ein essenzieller Bestandteil jedes Gens und liegt jeweils am 5'-Ende des Nichtmatrizenstranges und somit in Syntheserichtung vor dem RNA-codierenden Bereich. Genauer wirst Du den Promotor im Kapitel Genregulation kennenlernen.

=> Die RNA-Polymerase läuft entlang des codogenen Stranges in 3’ -> 5’ Richtung! (genau wie auch die DNA-Polymerase bei der Replikation).
Daher wächst die mRNA vom 5' zum 3' Ende!

 

Termination: Stopp der Transkription durch Terminatorsequenzen => Ablösen des Transkriptes von der DNA => Lösen der RNA-Polymerase => Bindung der DNA-Einzelstränge zur Doppelhelix.
Bei Erreichen einer Stopp-Stelle (Terminator) wird die Transkription beendet.

 

Prozessierung: Die gebildete Primärtranskripte durchlaufen im Zellkern der Eukaryoten einen Reifungsprozess (chemischer Prozess) zu funktionsfähigen, d. h. translationsfähigen mRNA Molekülen.

Durch die Transkription wird eine einsträngige m-RNA gebildet, welche vom Zellkern ins Cytoplasma zu den Ribosomen transportiert wird und dort als „Bauplan“ für Proteine dient.

Darstellung der Transkription (Genexpression)

 

 

Alternative Darstellungen: Transkription

 

Prtoteinbiosynthese - Transkription

Quelle Bild: Public domain by Wikicommonsuser Hoffmeier & National Human Genome Research Institute, http://www.genome.gov/Images/EdKit/bio2c_large.gif; http://commons.wikimedia.org/wiki/Image:DNA_transcription.gif

 

Die Proteinbiosynthese bei Eukaryonten II: Ablauf der Translation:

Die Translation ist die Übersetzung des genetischen Codes in eine Aminosäurefolge. Sie ist die eigentliche Synthese des Proteins an den Ribosomen.

Um die Translation zu verstehen, muss man vorher zwei Dinge verstehen:

a) den Aufbau von Ribosomen

b) den Aufbau der tRNA

 

a) Aufbau der Ribosomen

Ribosomen unterscheiden sich bei Pro- und Eukaryoten. (Details dazu unter der Überschrift: „Das Ribosom“). Ribosomen sind Zellorganellen, welche aus Proteinen und Ribonukleinsäuren (rRNA) bestehen. Sie kommen im Zellplasma aller Zellen (Prokaryoren und Eukaryoten) vor. Ihre Funktion liegt in der Synthese von Eiweißen (Proteinen), welche sie nach der Vorlage einer mRNA herstellen. In jeder Zelle sind enorm viele Ribosomen enthalten - je nach Funktion der Zelle, können es Hunderttausende sein. So findet man in dem Darmbakterium Escherichia coli (E-coli) ca. 15000 Ribosomen.

Ribosomen bestehen aus zwei Untereinheiten. Sie werden als kleine und große Untereinheit bezeichnet. Entsprechend ihres Gewichts, haben sie Namen, nach ihrer Sedimentierungsgeschwindigkeit (siehe Tabelle)

 

Ribosomen der Prokaryoten

Sie haben 70S Ribosomen, welche sich aus einer kleinen 30S und einer größeren 50S Untereinheit1 zusammensetzen.

 

Ribosom

Untereinheit

rRNAs

Proteine

70 S

50 S

23 S (2904 nt)

34

5 S (120 nt)

30 S

16 S (1542 nt)

31

 

S gibt den Sedimentierungkoeffizienten an

nt = Nukleotide

 

Ribosomen der Eukaryonten

Höhere Zellen haben etwas schwerere Ribosomen. Diese 80S Ribosomen setzten sich aus kleinen 40S und einer großen 60S Untereinheit zusammen.

Ribosom

Untereinheit

rRNAs

Proteine

80 S

60 S

28 S (4718 nt)

49

5,8 S (160 nt)

5 S (120 nt)

40 S

18 S (1874 nt)

33

1 S ist de Maßeinheit der Sinkgeschwindigkeit in Flüssigkeiten. Sie dient dem Unterscheiden der Ribosomen.

 

Zeichung eines Ribosoms währen der Translation

 

 

Quelle der Vorlage: Public domain by wikicommonsueser LadyofHats (Marina Ruiz) - muchas gracias; http://commons.wikimedia.org/wiki/File:Ribosome_mRNA_translation_en.svg

In beiden Zelltypen verknüpft jeweils die größere der beiden Untereinheiten während der Proteinbiosynthese die Aminosäuren zu einer Polypeptidkette. Die kleinere Untereinheit hingegen bindet die dazu notwendige mRNA. Beide Untereinheiten bestehen aus Proteinen und rRNA (ribosomale RNA). Die rRNA hat v.a. eine Funktion als Gerüstsubstanz, dient aber auch dem Erkennen von mRNA.

 

Alternative Darstellung:

Ribosom zerfällt in zwei Untereinheiten

 

Das Ribosom besteht aus zwei Untereinheiten: 30S Untereinheit 50S Untereinheit

Quelle Bild: Public domain by Protein data Bank - David S. Goodsell of The Scripps Research Institute & Wikicommonsuser Giac83 - Thank you http://commons.wikimedia.org/wiki/Image:Ribosome_(bacteria).jpg; http://www.pdb.org/pdb/static.do?p=education_discussion/molecule_of_the_month/pdb10_1.htm

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Ribosom

http://de.wikipedia.org/wiki/Sedimentationskoeffizient

 

b) Die tRNA - „Übersetzerin des Codes“

t-RNA - beladen und unbeladen


a) Aufbau der t-RNA

Das Anticodon besteht aus 3 Basen die zum Basentriplett der m-RNA komplementär sind.

 

b) Das Codon ist das „Wort“ der tRNA

Der genetische Code ist jeweils in Dreiergruppen aufeinanderfolgender Nukleotide (auch Tripletts oder Codons genannt) geschrieben. Dem entsprechen die Anticodons der tRNA,

Wie kann eine Folge von Basen (Basensequenz) eine Aminosäuresequenz codieren?
Es gibt nur 4 Basen aber 20 AS!

Wörter (= Codons) mit 1 Buchstaben => 4 verschiedene AS codierbar.

Wörter (= Codons) mit 2 Buchstaben => 42 = 16 verschiedene AS codierbar.

Wörter (= Codons) mit 3 Buchstaben => 43 = 64 verschiedene AS codierbar.

 

=> Je 3 Basen bilden ein „Codon“ und entsprechen somit einer AS

- Es gibt 64 mögliche Codons, im Menschen davon 61 für die 20 AS

- Für fast alle AS gibt es mehrere Codons. Das heißt der genetische Code ist degeneriert2.

- Codons einer AS unterscheiden sich in der Regel nur in der dritten Base.

- Ein bestimmtes Codon bedeutet in allen bisher untersuchten Organismen die selbe AS => der genetische Code ist also universell.

 

Das Ribosom hat drei Bindungsstellen:

Eingang: A-Stelle

Prozession: P-Stelle

Ausgang: E- Stelle (E = Exit)

http://de.wikipedia.org/wiki/TRNA

 

 

Darstellungen einer tRNA

 

 

Tertiärstruktur der t-RNA

Tertiärstruktur der t-RNA

Sekundärstruktur der t-RNA

Sekundärstruktur der t-RNA

unten sieht man das Anticodon

Quelle Bild: Public Domain by Wikicommonsuser Vossman - thank you! Quelle Bild: GNU-Lizenz für freie Dokumentation by Wikipedia http://commons.wikimedia.org/wiki/Image:3d_tRNA.png user tetamin & lliaca; http://de.wikipedia.org/wiki/Bild:TRNA.jpg http://de.wikipedia.org/wiki/Wikipedia:Lizenzbestimmungen

 

Farbgebung:

  • schwarz: Anticodon
  • rot: D-Arm
  • orange: CCA Ende
  • violett: Acceptor Stamm
  • blau: Anticodon Arm
  • grün: T-Arm

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Bild:TRNA.jpg

http://de.wikipedia.org/wiki/TRNA

 

c) Die Translation

In den Ribosomen „stehen“ bereits die notwendigen Aminosäuren sowie ein Helfer, die so genannte transfer-RNA (=tRNA) bereit. Sie werden für eine Translation (=Übersetzung) genutzt.

Ablauf der Translation in der Übersicht:

- m-RNA bindet an Ribosomen.

- Beladen der t-RNA mit einer AS durch Synthetase (ATP-Verbrauch).

- Paaren von Anticodon der t-RNA mit Codon der m-RNA.

- Bildung einer neuen Peptidbindung (Peptidkette hängt an t-RNA).

- Ablösung der t-RNA des vorherigen Codons.

- Beendigung der Translation am Stop-Codon (keine t-RNA vorhanden).

- Bei der Translation bewegt sich das Ribosmon vom 5’ zur 3’ Ende der mRNA.

Für jedes Codon existiert eine Transfer-RNA (t-RNA).

Translation: Übersetzen der genetischen Information aus der Basensequenz der m-RNA in die AS-Sequenz des Proteins.

 

Ablauf der Translation im Detail:

Proteinbiosynthese: Translation im Detail

 

Quelle Bild: Public domain by wikicommonsueser LadyofHats (Marina Ruiz) - muchas gracias; http://commons.wikimedia.org/wiki/File:Ribosome_mRNA_translation_en.svg

 

Initiation: Bildung des Initiationskomplexes durch Vereinigung der ersten mRNA (Startcodon AUG) mit der kleineren ribosomalen Untereinheit. Dann dockt anschließend die große ribosomale Untereinheit an. Die Start-t-RNA (mit Anticodon UAC/beladen mit F-Met) tritt an die P-Stelle.

 

Elongation: In der Kettenwachstumsphase kommt es zur zyklischen Wiederholung von 3 Reaktionsschritten:

1. Bindung einer beladenen tRNA (Aminoacyl-tRNA) in der A-Stelle (Codon-Anticodon [Schlüssel-Schloss-Prinzip]).

2. Polypeptid wird durch eine Peptidbindung auf die Aminosäure in der A-Stelle übertragen (=Peptidyltransfer).

3. Translokation, die Peptidyl-tRNA rückt mit der mRNA um ein Triplett in die P-Stelle weiter. Die entladene tRNA rückt in die E-Stelle und wird dort abgegeben (=> freie tRNA). Die frei gewordene A-Stelle kann erneut besetzt werden und ein weiterer Elongationszyklus beginnt.

 

Termination: Wenn nach erfolgter Translokation eines der 3 Terminationscodogene (Stoppcodone: UAA, UAG, UGA) in der A-Stelle auftritt, wird die Proteinsynthese abgebrochen.
Die letzte t-RNA wird abgespalten und das Polypeptids wird freigesetzt. Es kommt zur Dissoziation (Molekülzerfall) des Translationskomplexes (also des ganzen Ribosoms in seine beiden Untereinheiten).

 

d) Das allosterische Dreistellenmodell der Ribosomenfunktion

Diese Modellvorstelung erklärt die drei Schritte der Translation im Detail.

allosterische Dreistellenmodell der Translation und der Ribosomenfunktion

 

Ribosom von vorn und Ribosom „geöffnet“

 

Das Ribosom verfügt über drei tRNA-Bindungsstellen:

die A-(Aminoacyl-)-Stelle - hier bindet die mit AS beladene tRNA an das Ribosom.

die P-(Peptidyl-)-Stelle - hier sitzt die tRNA mit der wachsenden Aminosäurekette.

die E-(Exit-)- Stelle - hier verlassen die entladenen tRNAs das Ribosom.

 

Das Ribosom startet am Startcodon (m-RNA: AUG - Methionin) an der Eingangstelle A. Die nächste beladenen t-RNA kommt an die A Stelle, während die t-RNA mit Methionin schon weiter gerückt ist. Jede t-RNA trägt nur eine AS. Während die Elongation abläuft, wechselt das Ribosom immer zwischen den beiden Zuständen, welche durch die Anknüpfung der Aminosäuren gekennzeichnet sind. In beiden Zuständen sind immer zwei der drei tRNA-Bindungsstellen mit einer tRNA besetzt. Sobald eine t-RNA abgeworfen wurde, rückt die nächste an die A-Stelle des Ribosoms. Dabei wandern beide Untereinheiten immer ein Triplett weiter (von 5‘ zu 3‘ Richtung).

Im prätranslationalen Zustand sind die A- und P-Stelle besetzt, wobei die P-Stelle die tRNA mit der Polypeptidkette trägt und die A-Stelle von der neu hinzugekommen tRNA besetzt ist. Im Ribosom wird nun die Polypeptidkette von der P-Stellen-tRNA auf die A-Stellen-tRNA übertragen. Der posttranslationale Zustand schließt sich an. Das Ribosom bewegt sich um drei Basen auf der mRNA weiter. Dabei wird die vorherige A-Stellen-tRNA zur P-Stellen-tRNA. Diese entladene P-Stellen-tRNA verlässt über die E-Stelle das Ribosom. Entladene t-RNAs werden abgespalten und können durch ATP-Verbrauch wieder neu beladen werden, indem sie wieder die zum Anticodon passende AS aufladen. Dieser Vorgang wiederholt sich, bis das Ribosom an eine Stopptriplett gelangt. Das Ribosom zerfällt daraufhin in seine Untereinheiten, die m-RNA wird frei und das neue Polypeptid windet sich nach und nach zur Tertiärstruktur auf.

 

Die Codonsonne

Zum Entziffern des Erbguts ist eine Übersetzungstabelle (im Grunde ein Wörterbuch) notwendig. Die Codonsonne übersetzt zwischen der Basensequenz eines Tripletts und den dazugehörigen Aminosäuren. 61 Codons stehen für 21 Aminosäuren. 3 weitere Codons sind so genannte Stoppcodons. Sie beenden die Proteinsynthese.

Innen ist das 5‘ Ende und außen das 3‘ Ende!

Die Codonsonne

 

Eukaryoten verwenden als Startcodon fast immer AUG!

AUG codiert gleichzeitig für die Aminosäure Methionin. Also steht Anfangs an einer Polypeptidsequenz erstmals Methionin. Dieses wird dann aber enzymatisch abgespalten. Bei Prokaryoten treten neben AUG auch GUG und UUG als Startcodons auf. So nutzt beispielsweise Escherichia coli die Codons AUG (77 %), GUG (14 %), UUG (8 %) sowie wenige weitere!

 

Translation von DNA zum Polypeptid mithilfe der Codesonne

Beachte: An einem mRNA-Molekül werden gleichzeitig mehrere Polypeptide synthetisiert.

 


Ein Beispiel:

-------> Leserichtung ------->

DNA 5‘ A T G G A A A T G A T A 3‘ - nicht abgelesener Matrizenstrang

DNA 3‘ T A C C T T T A C T A T 5‘ - codogener Matrizenstrang

mRNA: 5‘ A U G G A A A U G A U A 3‘ - Codon

tRNA U A C C U U U A C U A U - Anticodon (an tRNA)

Met------Glu------Met------Ile

Die Translation ist die Übersetzung des genetischen Codes in eine AS-Folge.

Die Translation ist die eigentliche Synthese des Proteins an den Ribosomen. Dazu bindet mRNA an Ribosomen, tRNA bindet mit AS und verknüpft sich entsprechend kurzzeitig mit dem Codon der mRNA, Bildung einer neuen Peptidbindung, Beendigung der Translation am Stop-Codon.

 

Kettenabbruch durch Stoppcodone:

Es gibt insgesamt 3 verschiedene Stoppcodone, die früher nach Farben benannt wurden. Für diese Stoppcodons gibt es keine entsprechenden tRNA mit entsprechenden Anticodons. Sobald also ein Stoppcodon an die A-Stelle des Ribosoms gelangt, öffnet sich dieses in seine beiden Untereinheiten und gibt die fertige Aminosäuresequenz frei.

 

Zusatzinformation:

http://de.wikipedia.org/wiki/Codon

http://de.wikipedia.org/wiki/Genetischer_Code

http://de.wikipedia.org/wiki/Translation_(Biologie)

 

Übersetzung der mRNA in Triplettcodons

Übersetzung der mRNA in Triplettcodons

Quelle Bild: Public Domain by www.genome.gov: "Courtesy: National Human Genome Research Institute." Thank you; http://www.genome.gov//Pages/Hyperion/DIR/VIP/Glossary/Illustration/Images/

 

Zusammenfassung Genexpression

a) Übersicht der Proteinbiosynthese

Übersicht der Proteinbiosynthese

 

Quelle Bild: Public Domain by Wikicommonsuser Sverdrup & ToNToNi & www.genome.gov: "Courtesy: National Human Genome Research Institute." Thank you http://www.genome.gov//Pages/Hyperion/DIR/VIP/Glossary/Illustration/mrna.cfm; http://commons.wikimedia.org/wiki/Image:MRNA-interaction.png; Lizenz: http://www.genome.gov/12514471

Genexpression in der Übersicht

Quelle Bild: Public Domain by Wikicommonsuser Chb & www.genome.gov: Thank you http://www.genome.gov//Pages/Hyperion/DIR/VIP/Glossary/Illustration/mrna.cfm; http://de.wikipedia.org/wiki/Bild:Ribosom_funktion.png

 

 

b) In welche Richtung laufen Transskription und Translation ab?

a) Transskription

Der codogene Strang der DNA ist der Strang, welcher von der RNA-Polymerase abgelesen wird. Dazu wird der codogene (3‘ -> 5‘) Strang der DNA abgelesen. Die RNA-Polymerase arbeitet dann (so wie immer) vom 5‘ Ende zum 3‘ Ende. Die Nukleosid-Triphosphate werden also immer (unter Abspalten der beiden Phosphate) an das freie 3‘ Ende der wachsenden mRNA-Kette zugefügt.

 

b) Translation

Die mRNA wird vom 5‘ Ende zum 3‘ Ende bearbeitet. Dabei gilt dann für die Tripletts: Die erste Base eines Triplettscodons der mRNA ist komplementär zur dritten Base des Anticodons der tTNA.

 

Der genetische Code

Der genetische Code aller Lebewesen ist ein so genannter Triplettcode. Je drei Basenpaare entsprechen dann einer Aminosäure. Das heißt, das alle für Lebewesen wichtigen Aminosäuren (20+1) von nur vier Basen codiert weder.

=> ein Triplett der m-RNA (Codon) steht für eine bestimmte Aminosäure.

=> 64 Tripletts bestimmen 20 verschiedene Aminosäuren.

- Der genetische Codeist ein Triplett-Code. Der Ausfall eines Tripletts verändert Dreierableserhythmus nicht. Fällt aber eine Base aus, geschieht dies schon (=Punktmutation).

- Der genetische Code ist eindeutig und zweifelsfrei! => eine bestimmte Nukleotidsequenz definiert eine unveränderliche Aminosäuresequenz.

- Als Beweis dient ein Versuch aus dem Jahre 1961: Man stellte eine künstliche m-RNA, bestehend nur aus Uracil her. In der Proteinbiosynthese wurden nur die Aminosäure Phenylalanin (UUU) gefunden.

- Zwei verschiedene Basentripletts codieren in der Regel verschiedene AS.

- Der genetische Code ist universell!. Da dieser genetische Code bei allen Organismen gilt, ist dies ein Beweis für den gemeinsamen Ursprung aller Lebewesen.

- Der genetische Code ist eindeutig! Man sagt, der genetische Code ist zwar „degeneriert“, da zwar jedes Triplett eindeutig für eine bestimmte Aminosäure steht, aber umgekehrt, nicht jedes Aminosäure auch nur einem Triplett entspricht.

- Der genetische Code ist „kommafrei“. Die Tripletts sind lückenlos miteinander verbunden. Eine fehlende (oder eine überschüssige) Base verschiebt den Triplettcode.

- Nukleotide überlappen nicht! (d.h., ein Nukleotid ist immer nur Bestandteil eines Tripletts.)

- Der genetische Code wird vom 5‘ Ende zum 3‘ Ende abgelesen.

 

Übersicht über die Aminosäuren

 

Alanin

Ala

=> GCU, GCC, GCA, GCG

Arginin

Arg

=> CGU, CGC, CGA, CGG, AGA, AGG

Asparagin

Asn

=> AAU, AAC

Asparaginsäure

Asp

=> GAU, GAC

Cystein

Cys

=> UGU, UGC

Glutamin

Gln

=> CAA, CAG

Glutaminsäure

Glu

=> GAA, GAG

Glycin

Gly

=> GGU, GGC, GGA, GGG

Histidin

His

=> CAU, CAC

Isoleucin

Ile

=> AUU, AUC, AUA

Leucin

Leu

=> UUA, UUG, CUU, CUC, CUA, CUG

Lysin

Lys

=> AAA, AAG

Methionin

Met

=> AUG

Phenylalanin

Phe

=> UUU, UUC

Prolin

Pro

=> CCU, CCC, CCA, CCG

Serin

Ser

=> UCU, UCC, UCA, UCG, AGU, AGC

Threonin

Thr

=> ACU, ACC, ACA, ACG

Tryptophan

Trp

=> UGG

Tyrosin

Tyr

=> UAU, UAC

Valin

Val

=> GUU, GUC, GUA, GUG

START

 

=> AUG, GUG

STOPP

 

=> UAG, UGA, UAA

 

grau => hydophob (wasserabweisend, unpolar)

grün => hydrophil (wasserlöslich, polar) und neutral

hellblau => hydrophil und alkalisch

rot => hydrophil und sauer

 

 

Zusatzinformation

  • f-Met, weil es ein Startcodon ist! Met wird hingegen eingebaut. Beide unterschieden sich chemisch minimal!
  • Eine Besonderheit liegt bei der Sequenz AUG vor. Sie dient sowohl als Codon für Methionin sowie als Startcodon der Translation
  • Es gibt drei Stopp-Codons. Sie wurden früher nach ihrem Entdecker „Bernstein“ nach Farben benannt (UAG = amber, UGA = opal, UAA = ochre)

 

Übung zur Translation

Translation - Übungsaufgabe zum Verständnis

 

 

Lösung: F-Met-Val-His-Leu-Thr-Pro-Glu

 

 

Erkläre die Bedeutung der folgenden Grafik

Das Dogma der Genetik (Zeichnung)

 

 

Zentrales Dogma der Molekulargenetik

Die Vorgänge der Replikation, Transkription und der Translation bilden das „Zentrale Dogma“ der Molekulargenetik:

 

Zentrales Dogma der Genetik

Geschwindigkeit der Ablesung

Replikation: 40.000 Bp/min

Trankription: 1.500 N/min

Translation: 600 AS/min (= 1.800 N/min)

 

Wie kann man herausbekommen, welches Codon für welche Aminosäure steht?
=> Einsatz definierter DNA-Fragmente und anschließende Untersuchung des neuen AS-Strangs

Poly-AAA => Eine AS-Kette nur aus miteinander verknüpften Lys entsteht

Poly-UUU => Eine AS-Kette nur aus miteinander verknüpften Phe entsteht

Poly-CCC => Eine AS-Kette nur aus miteinander verknüpften Pro entsteht

Poly-GGG => Eine AS-Kette nur aus miteinander verknüpften Gly entsteht

 

Poly-AC => Thr, His, Thr, His usw. => Beweis für Codons mit ungerader Buchstabenzahl

 

 

Zusatzinformationen:

  • Bakterien haben etwas andere Ribosomen als Eukaryontenzellen.
  • Einige Antibiotika behindern die Proteinsynthese der Bakterien, da sie die Funktion speziell diese Ribosomen stören.

http://de.wikipedia.org/wiki/M-RNA

http://de.wikipedia.org/wiki/t-RNA

http://de.wikipedia.org/wiki/Proteinbiosynthese

http://de.wikipedia.org/wiki/Proteine

 

 

Die Wobble Hypothese zum degenerierten Code der DNA

Die dritte Base der tRNA kann sich in vielen Fällen unterscheiden und trotzdem bindet die gleiche Aminosäure. Dies sieht man auch in der Codesonne, so dass es für einige Aminosäuren durchaus vier verschiedene Codons gibt.

Verknüpfung von Purinbase und Pyrimidinbase über WBB

 

mRNA Codon
3. Base

tRNA Anticodon 1. Base

G

C

U

A

A, auch G

U, Ψ

C, auch U

G

U, C, oder A

I

 

Quelle Bild: GNU Free Documentation License by Wikicommonsuser G3pro; http://en.wikipedia.org/wiki/Image:WobbleBasePairsUracil.jpg

 

Informationen:

http://de.wikipedia.org/wiki/Wobble-Hypothese

 

Aufgaben:

1. Was ist ein Primer, was macht die Primase?

2. Was ist der Unterschied zwischen einem Promoter und einem Primer

3. Was hat die Polymerase mit dem Primer zu tun?

4. Welche Arten der Polymerase gibt es?

5. Was bezeichnet der Genetiker als Matrizenstrang?

6. Was ist ein Codon, was ein Anticodon?

7. a) Übersetze den codogenen DNA Strang in mRNA: AAATGCGCG

b) nenne die entsprechenden Anticodonender drei tRNA Moleküle, die sich bei der Proteinbiosynthese an diese Moleküle anlagern würden.

8. Wann und wo findet die Transkription statt?

9. Erstelle ein Schema, welches die Transkription und den Transport der mRNA erklärt

10. Erkläre die Translation

11. Stelle die AS-Sequenz des Proteins auf, welches sich aus der folgenden m-RNA ergibt:

Beginn 5' Ende 3'

aug gca gca ucg aag uag

12. Bestimme das Peptid, das in folgendem DNA-Abschnitt codiert ist:
5' TTT CAC ATG GCA AAA TTG 3'
codogener Strang 3' AAA GTG TAC CGT TTT AAC 5'

 

 

Ist der genetische Code für alle Lebewesen universell gültig?

Im Laufe der letzten Jahrzehnte wurden sehr viele Lebewesen untersucht. Mittlerweile weiß man, dass der genetische Code (fast) universell ist.

Doch auch einige Ausnahmen sind bekannt:

a) Prokaryoten:

Bei dem sehr ursprünglichem Prokaryoten Mycoplasma capricolum codiert das Triplett UGA nicht ein Stoppsignal, sondern die AS Tryptophan (Trp)

 

b) Eukaryoten:

  • Bei allen Cilliaten (Wimperntierechen, wie z.B. das Pantoffeltierchen Paramecium) sind die Tripletts UAA und UAG ebenfalls keine Stoppcodone. Sie codieren hier die AS Glutamin (Glu).
  • In Mitochondrien und Chloroplasten gibt es ebenfalls geringe Abweichungen vom üblichen genetischen Code.

Die Gemeinsamkeit des genetischen Codes (fast) aller Lebewesen kann als Beweis für eine Verwandschaft der Lebewesen und einen gemeinsamen Ursprung dienen.

 

Aufgaben

1. Durch Gentechnik werden heute Medikamente wie das Insulin hergestellt (Hormonproteinen). Dazu werden Bakterienzellen umprogrammiert, Insulin herzustellen. Dies ist ein sehr komplexer Vorgang. Warum reicht es nicht, wenn man einfach das menschliche Gen zur Insulinsynthese in Bakterien einschleust? Genauso wenig kann man einfach die entsprechende menschliche Insulin-mRNA einschleusen. Erkläre diese Befunde.

2. Eine Form der Blutkrankheit ist die „Thalassämie“. Sie wird durch das Fehlen eines Proteins verursacht. Thalassämieerkrankte haben in ihrem Blut anstelle des normalen Proteins ein sonst nicht in Menschen vorkommendes Protein. Vergleicht man das entsprechende Protein, so ist bei gesunden Menschen und bei Erkrankten der Anfang des Proteins identisch. Im mittleren Teil des Proteins kommt es aber zu einer enormen Abweichung, ausgelöst durch eine völlig andere Aminosäuresequenz. Weiterhin ist das Protein der Erkrankten wesentlich länger. Nenne Ursachen und Folgen!

3. Ordne die Begriffe des Fertig-Hausbaus denen der Proteinbiosynthese bei diesem analogen Vergleich zu:

Im Büro des Architekten (1) liegen Pläne (2) für eine Reihenhaussiedlung vor, in der Reihe von verschiedenen Fertighaustypen (3) entstehen soll. Mit Hilfe eines Fotokopierers (4) werden Kopien der Pläne für eines der Fertighäuser (5) hergestellt und mit dem Kurier zur Baustellen (6) gebracht.

Neben der Baustelle gibt es eine Lagerfläche (7) auf der die Fertigelemente und Bauteile (8) gelagert werden. Facharbeiter (9) ordnen diese nun den richtigen Kranwagen (10) zu. Die Kranwägen wiederum transportieren die Fertigteile zu den einzelnen Baustellen. Jeder Kranwagen trägt eine Erkennungsmarke (11), die zu den Kennziffern (12) der Bauplankopie passen.

Die Bauteile werden an den richtigen Stellen des Baugrunds abgestellt durch genormte Stahlkammern (13) miteinander verbunden. Das machen Bauarbeiter mit passenden Akkuschraubern (14). Die Batterien können jederzeit am nahegelegenen, mit Dieselöl (15) betriebenen, Klein-Kraftwerk (16) aufgeladen werden.

Fachausdrücke:
Ribosomen, DNA, Protein, Zellkern, t-RNA, Mitochondrien, Mg2+-Ionen, Cytoplasma, ATP, Aminosäuren, Glucose, m-RNA, RNA-Polymerase, Codon, Golgi-Apparat, Peptidbindung, Anticodon,
Nukleotid, Aminosäure-t-RNA, spezifische Enzyme.

 

Genexpression bei Eukaryoten

Grundsätzlich unterscheidet sich die Proteinbiosynthese der Prokaryoten und der Eukaryoten nicht wesentlich voneinander. Die ablaufenden Mechanismen sind die gleichen. Bei Eukaryoten gibt es aber Unterschiede in der mRNA. Kurz nach ihrer Entstehung ist sie länger als nach Ablauf einiger Zeit und als es das zu synthetisierende Protein erfordern würde. Diese Vorläufige mRNA wird auch Precursor-mRNA (auch Prä-mRNA) genannt. Sie ist ein identisches komplementäres Abbild der Eukaryoten-DNA. Aber was ist nun genau die Ursache für die Veränderung?

 

a) Exons & Introns

Eukaryotische DNA enthält nicht nur informationstragende Abschnitte (=Exons), sondern auch Bereiche, welche keinerlei Informationen tragen (=Introns). Diese Introns sind zwischen 50 und 30000 Nukleotiden lang. Introns können als Schleifen aus dem eigentlichen Strang hinausragen.

Introns enthalten zum Teil duplizierte Teile eines Gens, Bestandteile, welche im Verlauf der Stammesgeschichte funktionslos geworden sind, Überreste von Viren-DNA (besonders von Retroviren) oder auch nichtcodierende Desoxyribonukleinsäure (englisch noncoding DNA, auch junk DNA). Bei hochentwickelten Eukaryoten nehmen sie einen beträchtlichen Anteil des Erbguts ein. Bei Menschen bis zu 45% des gesamten Erbguts.

b) Spleißen (Splicing)

Die Precursor mRNA enthält noch alle Introns. Diese müssen nun in einem „Reifungsprozess“ durch Schneideenzyme hinausgeschnitten werden. Am Ende des Vorgangs steht die nur aus Exonen bestehende funktionsfähige RNA.

Der Vorgang des Hinausschneidens der Introns wird als Spleißen (engl. to splice = verbinden) bezeichnet. Er geschieht durch Spliceosomen (Spleißosomen) (=Enzyme). Splicing erfordert keine zusätzliche Energie (es wird kein ATP benötigt!). Die benötigte Energie entsteht durch das Spalten und Knüpfen von Bindungen.

 

Das Herausschneiden der Introns heißt RNA-Splicing.
Je komplexer ein eukaryotischer Organismus ist, desto umfangreichersind die Introns in seinen Genen.
Prokaryoten-DNA enthält übrigens keine Introns.

 

Quelle Bild: Public domain by wikicommonsuser Hoffmeier & National Human Genome Research Institute, http://www.genome.gov/Images/EdKit/bio2i_large.gif; http://commons.wikimedia.org/wiki/Image:DNA_exons_introns.gif

Proteinbiosynthese bei Eukaryoten: Reifung & Splicing

Aufgaben:

1. Was versteht man unter Exons und Introns?

2. Erkläre den Vorgang des Spleißens. Bei welchen Lebewesen tritt er auf.

3. Was versteht man unter „mRNA-Reifung“?

 

c) Alternatives Spleißen

Die Exons eines Gens müssen übrigens nicht immer in der gleichen Reihenfolge zusammengesetzt werden. So wird die Prä-mRNA eines Gens in Schilddrüse und Hypothalamus unterschiedlich „gespliced“. In der Schilddrüse werden vier Exone zur „Calcitonin-mRNA“ zusammengesetzt, welche das Peptidhormon Calcitonin codieren (das Hormon ist für die Regelung des Calcium- und Phosphathaushalt des Körpers verantwortlich).

Eukaryoten: Alternatives Spleißen

Im Hypothalamus wird einfach das letzte Exon durch ein anderes ersetzt, wodurch eine mRNA entsteht, welche ein Enzym zum Aufnehmen von Geschmacksstoffen codiert.

Quelle Bild: Public domain by wikicommonsuser Hoffmeier & National Human Genome Research Institute, http://www.genome.gov/Images/EdKit/bio2j_large.gif, http://commons.wikimedia.org/wiki/Image:DNA_alternative_splicing.gif

 

Anheften von Poly A -Schwanz und Cap-Hülle

Eukaryotische mRNA wird langsamer in der Zelle nach der Verwendung abgebaut. Der enzymatische Abbau stellt normalerweise wieder die benötigten RNA-Nukleotide bereit.
Dieser Schutz geschieht durch angeheftete Strukturen an beiden Enden der mRNA:
- am 3' Ende wird ein Poly A -Schwanz (bestehend aus 160-200 Adeninnukleotiden) angeheftet.

- am 5' Ende wird die Cap-Hülle (Cap-Struktur) angeheftet Sie besteht aus methyliertem Guanin.

Beide Enden schützen vor vorzeitigem Abbau und erleichtern zusätzlich die Bindung an das Ribosom.

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/Spleißen_(Biologie)

http://de.wikipedia.org/wiki/Calcitonin

 

Übersicht über das Splicing

Übersicht Splicing

Quelle Bild: Public domain by wikicommonsueser LadyofHats (Marina Ruiz) - muchas gracias; http://commons.wikimedia.org/wiki/File:RNA_splicing_diagram_en.svg

 

DNA Reparatur

Durch verschiedene Auslöser (z.B. mutagener Substanzen (z.B. Gifte & Radioaktive Stoffe), extremer Wärme, UV-Strahlen oder ionisierender Strahlung) kommen gelegentlich Mutationen der DNA zustande. Diese können als schadhafte Veränderungen der DNA zu

falschen Replikation der DNA in der Mitose führen. In der Folge werden Proteine nicht mehr bzw. falsch synthetisiert.

DNA Reparatur

Damit solche Schäden der DNA nicht die genannten Auswirkungen haben, gibt es komplexe Reperaturmechanismen der Zelle. Erst wenn zu viele Schäden vorliegen, (z.B. durch dauerhafte Exposition der Zelle zu Zellgiften wie Teer aus Zigarette, freie Radikale oder hohen Strahlendosen usw.) kommt die Zelle mit der Reparatur nicht mehr nach. Solche häufigen „Krebsereignisse“ führen dazu dass die Zellfunktion gestört ist. Solche Zellen werden soweit es geht vom Körper durch Apoptose entfernt. Wird die Zelle aber nicht als defekt erkannt, kann sie bei weiteren Teilungen außer Kontrolle geraten und so zur Bildung von Tumoren führen.

Mediziner schätzen, dass der menschliche Körper ca. bis zu 200-300 solcher Krebsereignisse am Tag (je nach Verfassung, Alter und Gesundheitszustand des Menschen) handhaben kann. Aber alleine der Genuss von 20 Zigaretten täglich, bei sonst gesunder Ernährung, führt zum Ansteigen auf einen Wert von über 1500 Krebsereignissen täglich!

Quelle Bild: Public domain by Wikicommmonsuser Lady Of Hats - Muchas Gracias; http://commons.wikimedia.org/wiki/Image:Dna_repair_base_excersion_en.svg

 

Zusatzinformationen:

http://de.wikipedia.org/wiki/DNA-Reparatur

Transposons

Transposons bei Zea mays (Mais)

Biologen haben beobachtet, dass sich sowohl bei Pro- als auch bei Eukaryoten bestimmte DNA Abschnitte von selbst aus ihrer Position im Chromosom lösen und an anderer Stelle wieder einfügen. Solche definierten und beweglichen DNA-Abschnitte, welche sich von selbst ablösen, nennt man Transposons oder springende Gene. Sie machen beim Menschen ca. 3% des Genoms aus. Durch den erneuten Einbau an einer neuen Stelle, verändert sich dort die Sequenz der Basenpaare, was in der Regel eine Inaktivierung des betreffenden Gens zur Folge hat.

Treten die Transposons wieder aus, wird das Gen wieder aktiv. Transposons wurden zuerst von der amerikanischen Botanikerin Barbara Mc Clintock bei Maiskolben entdeckt. Der Einbau eines Transposons verhindert die Bildung des braunen Kornfarbstoffes - es entstehen helle Maiskörner. Tritt das Transposon wieder aus dem Gen aus, so färbt sich das Korn dunkel.

 

Zusatzinformationen

http://de.wikipedia.org/wiki/Transposon

http://de.wikipedia.org/wiki/DNA-Transposon

http://de.wikipedia.org/wiki/Barbara_McClintock

Amazon Bestellung

Bitte Amazon hier bestellen: Bitte über dieses Fenster Eure Suche beginnen. Dies trägt für den Unterhalt dieser Homepage bei, kostet Euch nichts und ist anonym! Danke.